March 2013
Volume 54, Issue 3
Free
Erratum  |   March 2013
Erratum
Investigative Ophthalmology & Visual Science March 2013, Vol.54, 1705. doi:https://doi.org/10.1167/iovs.11-7287a
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Erratum. Invest. Ophthalmol. Vis. Sci. 2013;54(3):1705. https://doi.org/10.1167/iovs.11-7287a.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Erratum in: “Transforming Growth Factor–β Induces Extracellular Matrix Protein Cross-Linking Lysyl Oxidase (LOX) Genes in Human Trabecular Meshwork Cells” by Anirudh Sethi, Weiming Mao, Robert J. Wordinger, and Abbot F. Clark (Invest Ophthalmol Vis Sci. 2011;52:5240–5250) doi:10.1167/iovs.11-7287  
There is an error in the sequence of one of the LOXL1 PCR strands listed in Table 2. The correct PCR primer sequence pair should be: 
LOXL1 
Left: AGAGCCTCTCTGTCCACCAG 
Right: GTACACCTGCCCGTTGTTCT 
Citation: Sethi A, Mao W, Wordinger RJ, Clark AF. Erratum in: Transforming growth factor–β induces extracellular matrix protein cross-linking lysyl oxidase (LOX) genes in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011;52:5240–5250. DOI:10.1167/iovs.11-7287a  
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×