The presence of CD38 transcripts in the retinal pericytes was examined by RT-PCR after total RNA isolation with Trizol (Invitrogen), and reverse transcripted with random primers using a first-strand cDNA synthesis kit (Invitrogen). The primers used to amplify a 397-bp CD38 transcript were located on different exons to avoid false-positive results (P1, GTTTGCAGAAGCTGCCTGTGATGT, and P2, ACCAGCAGGTATGCTGAGTCATGT). The PCR reactions were carried out on a PTC-200 thermal cycler (MJ Research, Waltham, MA) with the following conditions: 94°C, 30 seconds, 58°C, 60 seconds, and 72°C, 60 seconds, 40 cycles. To detect CD38 protein on the cell surface of retinal pericytes, 2 × 105 of cells were cultured with or without 20 ng/mL of TNF-α (PeproTech, Rocky Hill, NJ), 300 U/mL of IFN-γ (PeproTech) or both for 48 hours. After this, the cells were stained with 10 μg/mL of an anti-CD38 IgG (Clone HIT2; Biolegend, San Diego, CA), or the same concentration of isotype control, following by flow cytometry analysis on a flow cytometer (LSR II; BD Bioscience, San Jose, CA).