In Vitro Amyloid Aggregate Forming Ability of TGFBI Mutants that Cause Corneal Dystrophies

Abstract

Purpose.: We investigated the in vitro amyloid aggregation ability of TGFBI (transforming growth factor beta-induced) mutants causing corneal dystrophies (CDs).

Methods.: Peripheral blood samples were collected from 42 unrelated Chinese CD patients and 185 healthy subjects for mutation screening in all TGFBI coding exons and flanking introns. The expression vector pCMV6_TGFBI containing wild-type, Arg-124, or Arg-555 mutations was transfected to HEK293 cells. Cell-free media was incubated with amyloid-beta (Aβ) (1-40) peptides with or without a chemical osmolyte, trimethylamine N-oxide (TMAO), for different time intervals. After ultracentrifugation, protein aggregates were analyzed by denatured gel electrophoresis. The effect of TMAO on chemical and morphological properties of Aβ aggregation was examined.

Results.: TGFBI sequencing analysis showed c.Arg124Cys in all 6 lattice CD patients, c.Arg555Glu in all 11 granular CD type 1 patients, and c.Arg124His in 22 of 25 granular CD type 2 patients. Double heterozygosity (c.307-308delCT and c.Arg124His) was detected in one GCD2 patient. After transfection, cell-free media containing Arg-124 TGFBIp led to Aβ aggregation within 12 hours, whereas wild-type and Arg-555 mutant displayed aggregation after 24 hours. Western blot and Congo red binding assays showed that TMAO dose-dependently suppressed Arg-124–induced Aβ aggregation. Transmission electron microscopy showed that TMAO reduced the fibrillar aggregates caused by Aβ and c.124R > H mutated TGFBIp.

Conclusions.: TGFBI sequence heterogeneity was observed in Chinese CD patients. TMAO reduced amyloid aggregation caused by Arg-124 mutants, which suggests a potential chemical-based treatment for CDs.

Introduction

Corneal dystrophy (CD) is characterized by a gradual progression of noninflammatory and bilateral opacities in a transparent cornea. It can cause severe visual impairment or repeated episodes of pain without permanent loss of vision. It usually requires surgical management, such as corneal transplantation or excimer laser ablation. ¹ With regard to the localization of opacity within the corneal layers (epithelial and subepithelial, stroma, Bowman, or Descemet/endothelial), CD is heterogeneous. ^2–4 It is usually inherited as an autosomal dominant trait with variable penetrance and expressivity, although autosomal recessive and X-linked inheritance are also found. The genetic alterations (mutations) have been mapped to more than 10 different chromosomes. Genotype-phenotype correlations for CD development have been found in 13 genes, including TGFBI (transforming growth factor, β-induced), CHST6 (carbohydrate [N-acetylglucosamine 6-O] sulfotransferase 6), COL8A2 (collagen, type VIII, α2), DCN (decorin), GSN (gelsolin), KRT3 (keratin 3), KRT12 (keratin 12), PIP5K3 (likely ortholog of mouse phosphatidylinositol-4-phosphate 5-kinase, type III), SLC4A11 (solute carrier family 4, sodium borate transporter, member 11), TACSTD2 (tumor-associated calcium signal transducer 2), TCF8 (transcription factor 8), UBIAD1 (UbiA prenyltransferase domain containing 1), and VSX1 (visual system homeobox 1). ^4–9  

The TGFBI (initially called β-induced gene human clone 3, βig-h3, or keratoepithelin, OMIM No. 601692) gene, which encodes TGFBIp (molecular mass ∼68 kDa) is linked to protein deposits in the corneal epithelium and stroma, a main cause of corneal dystrophy. ^10,11 TGFBIp contains four conserved fasciclin 1 (FAS1) domains and a carboxyl-terminal Arg-Gly-Asp (RGD) integrin-binding domain. It mediates integrin binding to extracellular matrix proteins for cell proliferation, adhesion, and migration. ¹² Specific mutations in two hot spots, Arg-124 in the first FAS1 domain and Arg-555 in the fourth FAS1 domain, are related with distinct clinical phenotypes: c.124R > C in lattice CD type 1 (LCD1), c.124R > H in Avellino CD (or granular CD type 2, GCD2), c.124R > L in Reis-Buckler CD, c.124R > S in granular CD, c.555R > W in granular CD Groenouw type 1 (GCD1), and c.555R > Q in Reis-Buckler CD (Human Gene Mutation Database). ⁸ In this study, we investigated the occurrence of exonic and intronic gene sequence variants of TGFBI in 42 Chinese patients with mixed subtypes of CDs. 

We also explored the effect of human wild-type (WT), Arg-124, or Arg-555 mutated TGFBIp on amyloid beta (Aβ) peptide aggregation in vitro. Although TGFBIp is expressed in various mammalian tissues and organs (http://www.genecards.org/), the pathologic deposition caused by mutated TGFBIp has been observed only in the cornea. TGFBIp aggregation could occur specifically in the cornea. ^{13 -15} Pathologic amyloid deposits are found with TGFBIp mutated at Arg-124 but not at Arg-555, ¹⁶ and the mechanism of amyloid conversion remains elusive. Besides its own deposition, mutated TGFBIp could cause other corneal proteins to aggregate. ¹⁷ Due to the colocalization of apolipoproteins J and E in the congophilic corneal amyloid deposits in CD, it has been proposed that amyloid conversion in CD corneas could share similarity with the brain tissue in Alzheimer's disease. ^{18 -20} In addition, increased Aβ precursors are detected in corneas of Alzheimer's mice. ²¹ The question arises as to whether WT and mutant TGFBIp modulate Aβ aggregation. We therefore performed an in vitro study to explore the Aβ aggregation effect of CD-causing TGFBI mutants. We also explored a novel screening methodology for determining the amyloidogenicity of TGFBIp mutants and their possible rescue by trimethylamine N-oxide (TMAO), a small natural osmolyte with reported chaperoning activity. 

Materials and Methods

Study Subjects

The study protocol was approved by the Ethics Committee on Human Research, The Chinese University of Hong Kong, and was in compliance with the tenets of the Declaration of Helsinki. Informed consent was obtained from all participants. After complete ophthalmic examination, including fundoscopy, slit-lamp biomicroscopy, and specular and confocal microscopies, ophthalmologists diagnosed 42 CD patients as having paricular CD subtypes. A detailed history, including family history and time of onset of symptoms, was recorded. Also recruited were 12 unaffected family members and 185 unrelated healthy subjects older than 70 years, the latter of whom did not have medical or family history of any ocular disorders except senile cataracts or mild myopia. All subjects underwent complete ophthalmic examinations. Intraocular pressure was measured by applanation tonometry and visual fields examination was performed using a perimeter (Humphrey Field Analyzer; Carl Zeiss Meditec, Dublin, CA). Visual acuity was determined using a Snellen's eye chart. 

Genotyping

Peripheral venous blood was collected for genomic DNA extraction using a QIAamp DNA Blood kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. All coding exons and flanking introns of TGFBI were amplified by PCR using specific oligonucleotide primers as shown in Table 1. The PCR product was subjected to conformation-sensitive gel electrophoresis, ²² and samples showing aberrant electrophoretic mobility were further analyzed by direct sequencing using a BigDye Terminator Cycle Sequencing Reaction Kit (version 3.1; Applied Biosystems, Foster City, CA) on an ABI 377 DNA sequencer (Applied Biosystems). Sequencing data were compared with the published TGFB1 sequence (GenBank Accession Number AY149344). 

Table 1. 

 

Specific Primers and Conditions for Amplification of TGFBI Coding Exons and Flanking Introns

Exon	Forward Primers (5′→3′)	Reverse Primers (5′→3′)	Annealing Temperature (°C)	Product Size (bp)
4	CCCCAGAGGCCATCCCTCCT	CCGGGCAGACGGAGGTCATC	60	225
5	TAAACACAGAGTCTGCAGCC	TTCATTATGCACCAAGGGCC	60	260
6	TGTGTTGACTGCTCATCCTT	CATTCAGGGGAACCTGCTCT	60	317
7	TTCAGGGAGCACTCCATCTT	ATCTAGCTGCACAAATGAGG	60	224
8	CTTGACCTGAGTCTGTTTGG	AGATGGTGGGCCAGGCAGGG	52	286
9	ACTTTTGAACCCACTTTCTC	CAATCTAACAGGGATGCCTT	55	200
10	TCTGGACCTAACCATCACCC	CAGGAGCATGATTTAGGACC	58	206
11	CTCGTGGGAGTATAACCAGT	GACATCCATGACAGTCCACAT	56	164
12	GTTGACAGGTGACATTTTCT	TCTTTACCCAAGAGTCTGCT	60	174
13	TTGACCAGGCTAATTACCATTC	CTGGGGAAATTTAGCCAGCC	61	225
14	CTACTTTCAACCACTACTCT	TCATCATTGTTTCGGACAGT	61	229
15	CACTCTGGTCAAACCTGCCT	GGCTAGGCGCAAACCTAGC	61	109
16	CAGTTGCAGGTATAACTTTC	TAAACAGGTCTGCAATGACT	61	120

Expression Constructs and Mutagenesis

A C-terminal myc-FLAG-tagged full-length open reading frame clone of human TGFBI (NM_000,358.2), named pCMV6_TGFBI, was obtained from Origene (Rockville, MD). CD-causing mutations (c.417C > T for p.Arg124Cys, c.418G > A for p.Arg124His, c.418G > T for p.Arg124Leu, c.417C > A for p.Arg124Ser, and c.1710C > T for p.Arg555Trp) were introduced by PCR-based site-directed mutagenesis (Stratagene, La Jolla, CA) using specific oligonucleotides (Table 2), and the correctness of constructs was verified by direct sequencing. 

Table 2. 

 

Specific Oligonucleotides for Site-Directed Mutagenesis

Mutations	Amino Acid Change	Mutagenesis Oligos (sense) (5′-3′)
c.C417T	Arg124Cys	ACCACTCAGCTGTACACGGACTGCACGGAGAAGCTGAGGCC
c.C417A	Arg124Ser	ACCACTCAGCTGTACACGGACAGCACGGAGAAGCTGAGGCC
c.G418A	Arg124His	ACCACTCAGCTGTACACGGACCACACGGAGAAGCTGAGGCC
c.G418T	Arg124Leu	ACCACTCAGCTGTACACGGACCTCACGGAGAAGCTGAGGCC
c.C1710T	Arg555Tyr	GAGCCCTGCCACCAAGAGAACAGAGCAGACTCTTGGGAGATGC

Cell Culture, Transfection, and Small Molecule Treatment

Human embryonic kidney epithelial HEK293 cells (ATCC, Manassas, VA), at a density of 5 × 10⁴ cells/cm², were transfected with pCMV6_TGFBI (wild type or mutant) at a ratio of 3 μL FuGene HD reagent (Roche, Basel, Switzerland) per 1 μg DNA in Opti-MEM I supplemented with GlutaMAX-I (Invitrogen, Carlsbad, CA). After 1 day, the transfection medium was replaced with serum-free medium, which was then collected after another 24 hours. Secreted TGFBIp was assayed after immunoprecipitation (IP) with anti-myc antibody (Sigma, St. Louis, MO), followed by Western blotting (WB) for FLAG epitope (antibody from Sigma). 

Amyloid Beta Peptide Aggregation Analysis

Cell-free medium containing WT or mutant TGFBIp was incubated with 10 μM Aβ(1-40) peptides (>97% purity, rPeptide, Bogart, GA) for different time intervals. TMAO was added to a final concentration of 0 to 450 mM. Protein aggregates were harvested by ultracentrifugation, denatured in buffer containing 20 mM Tris (pH 6.8), 9 M urea, 2% SDS, 50 mM DL-dithiothreitol, and 10% glycerol, resolved with 12.5% SDS-PAGE and immunoblotted for Aβ(1-40) peptides using mouse monoclonal antibody 6E10 (Covance, Princeton, NJ). Media without transfected TGFBIp or with Aβ scrambled peptide (rPeptide) were used as controls. 

The relative abundance of fibrillar Aβ was determined by Congo red assay. In brief, conditioned medium (without phenol red) was added with 20 μM Congo red solution for 4 hours. The absorbance was measured at a wavelength of 540 nm with reference to 630 nm using a plate reader (Powerwave XS; Bio-Tek Instruments, Winooski, VT). The experiment was done in quadruplicate and means and SDs were calculated. 

Aβ structure was visualized by transmission electron microscopy (TEM). After ultracentrifugation, fibril aggregates were suspended in neutral phosphate buffer (10 μM) and added to 150-mesh formvar-coated copper grids for 2 minutes, washed in distilled water, and fixed with 4% glutaraldehyde (EM Sciences, Hatfield, PA). The samples were negatively stained by 3% uranyl acetate (Sigma) in methanol, washed, air-dried, and examined by TEM (Hitachi H-7100; Hitachi, Tokyo, Japan). 

Cellular Protein Expression Study

After 24 hours of treatment with or without TMAO, transfected cells were lysed in a radioimmunoprecipitation assay (RIPA) buffer with freshly added Complete protease inhibitor cocktail (Roche) and 1 mM phenylmethylsulfonylfluoride (Sigma). Soluble proteins were immunoblotted with mouse monoclonal antibodies against human caspase 3 (BD Biosciences, Franklin Lakes, NJ), p21^Cip (Millipore, Billerica, MA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Sigma), followed by appropriate Ig horseradish peroxidase conjugate (Jackson ImmunoLab, West Grove, PA). The immunoreactive signal was detected by enhanced chemiluminescence (GE Healthcare, Pittsburgh, PA). Band intensity was imaged and analyzed by Quantity One 4.6.2 (BioRad, Hercules, CA). 

Results

Single Nucleotide Polymorphism Association Analysis

We screened TGFBI for exonic and intronic sequence variants and found that 39 (93%) of 42 CD patients had heterozygous TGFBI mutations. Of these mutations, most were associated with either Arg-124 or Arg-555: p.Arg124Cys (R124C) in 6 of 6 LCD patients, p.Arg124His (R124H) in 22 of 25 GCD2 patients, and p.Arg555Trp (R555W) in 11 of 11 GCD1 patients (Table 3). Among these 42 patients, 30 were recruited from 10 different families. Only one mutation was inherited within the family. The distributions of detected mutations are summarized in Table 4. Three GCD2 patients were caused by non-TGFBI mutations after whole gene sequencing (data not shown). 

Table 3. 

 

Summary of TGFBI Mutations in Hong Kong Chinese CD Samples

CD Types	No. Patients	TGFBI Genotypes
		Arg124His	Arg124His + c.307-308delCT	Arg124Cys	Arg555Tyr	Non-TGFBI Mutation
GCD1	11	0	0	0	11	0
GCD2	25	22	1	0	0	3
LCD1	6	0	0	6	0	0

Table 4. 

 

TGFBI Mutations in the Studied CD Families

Family	Recruited Members (Total)	Proband (Sex/Age, Genotype)	Other Members (Sex/Age, Genotype)
CD1	4	ACD (F/18, R124H)	1 ACD (F/39, R124H)
			1 clear (M/13, R124H)
			1 clear (F/15, WT)
CD2	4	CDL1 (F/44, R124C)	2 CDL1 (M/14 & F76; both R124C)
			1 clear (F/17, WT)
CD3	2	ACD (M/70, R124H)	1 clear (M/61, WT)
CD4	3	ACD (F/58, unknown)	1 ACD (F/55, R124H)
			1 CDG1 (F/31, R124H)
CD5	2	ACD (F/26, R124H)	1 clear (M/63, WT)
CD6	5	CDG1 (M/35, R555W)	4 CDG1 (F/11, F/37, M/12, M/13; all R555W)
CD7	2	ACD (F/36, R124H)	1 clear (M/37, WT)
CD8	3	ACD (F/69, R124H)	1 ACD (F/71, unknown)
			1 ACD (F/38, R124H)
CD9	3	CDL1 (F/40, R124C)	1 CDL1 (F/31, R124C)
			1 clear (F/38, WT)
CD10	2	CDG1 (M/38, R124H)	1 clear (M/14, R124H)

 F, female; M, male

In a patient with GCD2, a second heterozygous mutation, a novel c.307_308delCT in exon 6, which results in a premature STOP codon at position 130, was identified in addition to p.Arg124His in exon 4. This mutation has not previously been reported. The patient was diagnosed with CD at the age of 28 and presented with bilateral multiple granular, refractile, ice flake–like gray-whitish opacities covering two-thirds of the cornea (Fig. 1). The morphology of deposits was different from that observed in another female GCD2 patient, who was heterozygous for p.Arg124His and who displayed diffuse granular deposits on the corneal surface. In the compound heterozygote, no filamentous lattice-type deposition was observed. Her visual acuity dropped to 18/100 in both eyes by age of 31. Left penetrating keratoplasty was performed at age 34, with best-corrected acuity improving up to 20/40 thereafter; however, recurrence occurred in the graft after 3 years, with visual acuity dropping to 4/200 before a second penetrating keratoplasty was performed. Later, she also received phototherapeutic keratectomy to reduce the granular opacities in the right eye, with visual acuity improving to 20/50. She has regular follow up visits at our clinic. Because no family member was willing to participate in this study, we were unable to perform segregation analysis. 

Figure 1. 

 

Slit lamp photographs showing (A) a GCD2 patient heterozygous for the p.Arg124His mutation and displaying diffused granular deposits on the corneal surface, and (B) a GCD2 patient compound heterozygous for p.Arg124His and c.307_308delCT and showing large granular whitish flake-ice like deposits covering two-thirds of the corneal surface.

Neutral single nucleotide polymorphisms of TGFBI were also detected. They were p.Leu217Leu in exon 6, p.Asn272Asn in exon 7, p.Val327Val in exon 8, c.IVS10-3C > T, p.Leu472Leu in exon 11, p.Phe540Phe in exon 12, and p.Leu601Leu in exon 13. Their occurrence rates were similar among CD patients and healthy subjects. 

R124 Mutant TGFBIp Accelerated Aβ(1-40) Aggregation

Next, we investigated the amyloidogenic properties of the commonly occurring mutant TGFBIp (R124C, R124H, R124L, R124S, and R555W). IP-WB analysis of transfected HEK293 cell medium detected a single FLAG-immunoreactive band at approximately 68 to 70 kDa, representing secreted TGFBIp (Fig. 2). In addition, intracellular TGFBIp was detected in soluble RIPA cell lysates. By examining the band intensity per 10⁵ cells, we found that TGFBI mutations did not affect the efficiency of protein secretion. Cell-free media from TGFBI transfectants was filtered through 22-μm micropores and incubated with Aβ(1-40) peptides. Protein aggregates were collected by ultracentrifugation, resolved in urea-containing sample buffer, and immunoblotted. At 24 hours, Aβ aggregates were detected in all TGFBIp-containing media (WT and mutants) and nontransfected control medium (Fig. 3A). Four major immunoreactive bands in gel were found: high molecular-weight aggregates (HMA, >150 kDa), medium molecular-weight aggregates (MMA, 80–100 kDa), small molecular-weight aggregates (SMA, 40–50 kDa), and oligomers (<20 kDa). More than 50% of Aβ was detected in the oligomeric form, with the remainder forming different sizes of aggregates (Fig. 3B). At 12 hours of incubation, unlike WT and R555 mutant, media with R124 mutant TGFBIp displayed Aβ aggregate formation (P < 0.05, Mann-Whitney U test). This assay thus demonstrated the heightened amyloidogenicity of R124 mutant TGFBIp, which has been reported to form an amyloid structure. 

Figure 2. 

 

Immunoblotting analysis of FLAG representing TGFBIp expression in HEK293 transfected with pCMV6_TGFBI plasmids containing WT, Arg-124 (R124), or Arg-555 (R555) mutants. IC, intracellular lysate; EC, extracellular lysate after immunoprecipitation with anti-myc antibody. Positive bands at approximately 68 to 70 kDa indicate the TGFBIp expression.

Figure 3. 

 

Aβ(1-40) peptide aggregation. From Western blotting, four major immunoreactive bands of Aβ aggregates and oligomers were quantified by Quantity One analysis. The relative abundance is calculated with reference to the in-gel signal. Arg-124 (R124) mutant TGFBIp showed the same degree of Aβ aggregation in 12 hours that WT and Arg-555 (R555) mutant exhibited in 24 hours. This histogram shows the mean value of relative abundance obtained from 3 individual experiments. *P < 0.05, Mann-Whitney U test.

TMAO Reduced Aβ Peptide Aggregation Caused by R124 Mutant TGFBIp

We tested if Aβ aggregation could be alleviated by TMAO treatment. Aβ(1-40) peptide (10 μM) was incubated in medium with secreted R124C or R124H TGFBIp in the presence of TMAO (0 to 450 mM) for 12 hours. Protein aggregates were harvested and resolved in 12.5% SDS-PAGE. After immunoblotting, we observed a dose-dependent decrease in Aβ aggregates (Figs. 4A, 4B). In untreated samples, massive aggregation of Aβ peptides was detected, similar to that described before. Such aggregation was reduced with the addition of TMAO concentrations above 50 mM (P < 0.05, Mann-Whitney U test) (Figs. 4C, 4D). The relative abundances of HMA, MMA, and LMA forms were collectively reduced, leaving most in-gel signals in the form of oligomers. The result was similar with WT TGFBIp. TMAO also reduced Aβ aggregation by R124L and R124S mutants (Figs. 4E, 4F). Fibrillar aggregates were detected after 12 hours incubation of Aβ peptides with R124 mutant media, as revealed by increased absorbance in the Congo red binding assay (Fig. 5). In contrast, Aβ only and Aβ in WT or R555W mutant media did not show any absorbance changes, indicating the absence of β-sheet structures. When TMAO (50 and 200 mM) was added to R124 mutant media for 12 hours, a significant decrease of Congo red absorbance was observed (P < 0.05, paired Student's t-test, n = 4). Only a slight decrease was found for 10 mM TMAO treatment. 

Figure 4. 

 

TMAO reduced Aβ peptide aggregation caused by Arg-124 mutant TGFBIp. (A) and (C) Western blot analysis of Aβ aggregate and oligomer formation by p.Arg124Cys (R124C) TGFBIp, their reduction by TMAO (5‐450 mM) and the relative abundance measurements (mean of 3 experiments). (B) and (D) p.Arg124His (R124H); (E) p.Arg124Leu (R124L); and (F) p.Arg124Ser (R124S). *P < 0.05, Mann-Whitney U test. nt, non-treated; scb, Aβ scrambled peptides.

Figure 5. 

 

Detection of Aβ fibrillar β-sheet aggregation by Congo red binding analysis. TMAO treatment dose-dependently reduced Congo red binding to Aβ aggregates caused by Arg-124 mutants after 12 hours of incubation. Reaction of Aβ peptides with WT or p.Arg555Trp (R555W) mutant and Aβ scrambled peptides only did not exhibit fibrillar aggregates positive for Congo red binding. *P < 0.05, paired Student's t-test, n = 3.

TEM verified the mixed appearance of fibrillar and aggregate morphology of Aβ peptide in preparations incubated for 12 hours with R124H mutant medium. Electron dense fibrillar aggregates were evident with a width of 400 to 500 nm, and some were arranged in globular clusters (Fig. 6A). With the presence of TMAO (50 mM), the samples predominantly contained small fibrillar fragments and aggregates (Fig. 6B). This resembled scrambled Aβ peptides or Aβ peptides treated with WT medium (Figs. 6C, 6D). 

Figure 6. 

 

Transmission electron micrographs showing Aβ peptide aggregates in 12 hours. (A) Aβ(1-40) peptide and R124H TGFBIp; (B) Aβ(1-40) peptide, R124H TGFBIp, and 50 mM TMAO; (C) Aβ(1-40) peptide and WT TGFBIp; and (D) Aβ scrambled peptide and R124H TGFBIp.

TMAO Reduced Caspase 3 Activation

HEK293 cells were transfected to express R124H TGFBIp. These cells were incubated with 10 μM Aβ(1-40) peptide in the presence of TMAO (0‐200 mM) for 24 hours. Soluble cell lysate was collected to study caspase 3 expression by WB. Similar to apoptotic control cells (after overnight serum depletion), WT and R124H mutant cells expressed active caspase 3 (15–20-kDa fragments) when incubated with Aβ(1-40) peptide (Fig. 7A). By band densitometry analysis, cells incubated with Aβ in the presence of the R124H mutant exhibited almost a 2-fold higher level of active caspase 3 than did cells incubated with WT TGFBIp (Fig. 7B). Cotreatment with TMAO suppressed active caspase 3. Treatment with 50 mM TMAO, but not other concentrations, resulted in up to 25-fold reduction of caspase 3 activation (P < 0.05, paired Student's t-test, n = 3). In addition, growth arrest p21 expression was also decreased after TMAO treatment (Fig. 7A). 

Figure 7. 

 

TMAO treatment reduced caspase 3 activation by p.Arg124His TGFBIp expression and Aβ peptide. (A) Immunoblot analysis of pro- and active caspase 3 in HEK293 cells transfected with WT or R124H (RH) TGFBIp. Incubation with 10 μM Aβ(1-40) peptide induced caspase 3 activation. This was alleviated by TMAO treatment. Cells with overnight serum depletion were used as control for caspase 3 activation. Expression of p21^Cip was also reduced after TMAO treatment. GAPDH was used as the internal control. (B) Histogram showing the relative percentage of active caspase 3 to pro-caspase 3 with treatments described in A.

Discussion

Mutations in the TGFBI gene cause several types of autosomal-dominant corneal dystrophies. In this study, we conducted a genotypic study on 42 Chinese patients with several phenotypically different CD subtypes. The c.417C > T (for p.Arg124Cys), c.481G > A (p.Arg124His), and c.1710C > T (p.Arg555Trp) mutations of the TGFBI gene segregated with LCD, GCD2, and GCD1, respectively. Although no TGFBI mutations were detected in three patients, our findings showed a similar causative effect of TGFBI mutations in various subtypes of CD in the Chinese as in other ethnic populations (Table 5). In Chinese, numerous studies have reported on TGFBI-linked CD genotyping. Analyzed from the literature with a total of 466 patients from 94 families and 13 sporadic patients, the classic genotypes for TGFBI-linked CD are p.Arg124Cys for LCD1, p.Arg124His for GCD1, p.Arg555Trp for GCD2 (Avellino), and p.Arg555Gln for CDTB. Other nonclassical variants were also reported, including p.Ala546Thr and p.Ala546Asp for GCD1; p.Pro501Thr, p.Arg514Pro, p.Phe515Leu, p.Ile522Asn, and p.His572Arg for LCD1; and p.Gly623Asp for CDRB. ^{23–25,41–60}  

Table 5. 

 

Reported TGFBI Mutations in Different Types of CD

Disease Type	Reported Mutations
LCD I	Arg124Cys 24,28–30 ; Val505Gln 25 ; Leu518Pro 31 ; Ala546Asp 27 ; Pro551Thr 27 ; Leu569Arg 32
LCD IIIA	Pro501Thr 33 ; Ala546Thr 26 ; Asn622Lys 28
LCD I/IIIA	Leu518Arg 28 ; Thr538Arg 28 ; ΔPhe540 28 ; Asn622His 34 ; Gly623Asp 28 ; His626Pro 28 ; His626Arg 24,28,34 ; p.629_630Ins 35
LCD IV	Leu527Arg 36
LCD-deep	Val631Asp 28
LCD-late onset	Asn544Ser 30
GCDI	Arg124Ser 28 ; Arg124His+ΔThr125-ΔGlu126 26 ; Arg555Trp 3,23,37
GCDII	Arg124His 3,37–39
CDB1 (CDRB)	Arg124Leu 28,40
CDB2 (TBCD)	Arg555Trp 3,40

We identified a novel deletion mutation, c.307_308delCT, in a GCD2 patient who also carried a heterozygous p.Arg124His change on the other chromosome. This deletion leads to a frameshift starting from codon 103 and results in a premature STOP at position 130. The amino acid sequence was changed from “LSNLYETLGVVGSTTTQLYTDRTEKLRP” (amino acids 128 to 155) to “LKPLRDPGSRWIHHHSAVHGPHGEAEAX.” As TGFBI-associated CD is inherited in an autosomal dominant manner, a heterozygous mutation is sufficient to produce the disease phenotype, even though homozygous TGFBI mutations could give rise to a more phenotypically severe, early-onset disease variant. The presence of a STOP codon in one allele, thus, represents a hemizygous situation that may alter or exaggerate the clinical phenotype. During her first visit at the age of 28, both corneas exhibited granular opacities in a dense confluent pattern covering two-thirds of the corneal surface, with white plaques extending to deep corneal stroma, resembling features described in patients with homozygous p.Arg124His. ⁶¹ The visual acuity of both eyes deteriorated but was improved by penetrating keratoplasty. She responded well to phototherapeutic keratectomy, with improved visual acuity and reduced granular opacities. Whether other carriers of c.307_308delCT show similar phenotypic changes is not examined because no family member participated in this study. Several cases of double mutations associated with CDs have been reported. A 6-bp deletion removing Thr-125 and Glu-126 was present with p.Arg124Leu on the same TGFBI allele in a patient with atypical GCD. ²⁶ In an LCD patient, a missense p.Pro551Gln on the same allele as p.Ala546Asp was identified. ²⁷ Three deletion mutations in the TGFBI gene have been reported. One was a 6-bp deletion in compound heterozygosity with p.Arg124Leu as mentioned above. ⁶² A Sardinian patient diagnosed with LCDI/IIIA had c.ΔF540. ⁶³ The third deletion, c.1926delG was found in an LCDIIIA patient. ²⁸ This resulted in a premature termination at codon 669. Both compound heterozygosity and deletion mutations in TGFBI are rare. 

Although the clinical and genetic information of this protein aggregation disorder is well documented, relatively little is known about this extracellular matrix protein, TGFBIp (or keratoepithelin). Some CDs are characterized by amyloid deposition in the corneal subepithelial or stromal region; however, the mechanisms of amyloid conversion remain unclear. TGFBIp is expressed in many tissues and organs (http://www.genecards.org/); however, the pathologic deposition caused by mutant TGFBIp was observed only in the cornea. This suggests a cornea-specific mechanism in the aggregation of mutated TGFBIp. TGFBIp with Arg-124 mutations can aggregate to form amyloid fibrils, whereas Arg-555 mutants have nonamyloid deposits. ¹² It has been shown that TGFBIp is proteolytically processed from the N-terminus and appears to be degraded in a highly orchestrated manner in human cornea with the resulting C-terminal fragments being retained in the cornea. ¹⁵ Whether the mutated TGFBIp generates cornea-specific fragments that aggregate is yet to be investigated. An additional possibility is that mutated TGFBIp could cause other corneal proteins to aggregate. ¹⁷  

In this study, we found that mutated TGFBIp promoted Aβ peptide aggregation. Aβ fibrils were detected when the peptides were incubated for at least 24 hours at 37°C; however, the presence of Arg-124 mutants (including p.Arg124Cys, p.Arg124His, p.Arg124Leu, and p.Arg124Ser) accelerated Aβ fibrillar aggregate formation at 12 hours, whereas WT and the Arg-555 mutants did not. This is in accordance with the clinical observations that Arg-124 mutants are linked to amyloidosis. ¹⁶ Under denaturation, Aβ peptide aggregates existed predominantly in the forms of high (>150 kDa), medium (80–100 kDa), and low (40–50 kDa) molecular mass aggregates as well as oligomers (<20 kDa). The relative abundance of such Aβ aggregates to oligomers was significantly increased after incubation with Arg-124 mutants, when compared with incubation with WT or the Arg-555 mutants. This demonstrated for the first time that TGFBIp could cause Aβ peptides to aggregate. 

TGFBIp was previously shown to bind to collagen I, integrins, and extracellular glycans. ^12,64 In normal human corneas, amyloid is occasionally detected in the sub-Bowman and stromal regions. The vascularization in CD corneas could allow more amyloid precursors or Aβ to be transported to the cornea, ⁶⁵ leading to progressive amyloid deposition. In LCDII patients, amyloid deposition was reported in cornea, sclera, lacrimal gland, and ciliary nerve. ⁶⁶ Although there is no report conclusively proving the presence of Aβ in human corneas, increased immunoreactivity to the Aβ region of amyloid precursors was detected in corneas of transgene mice models of Alzheimer's disease. ²¹ Aβ could serve as an important substrate for TGFBIp-induced protein aggregation. In addition to retinal ganglion cell loss, our finding of corneal opacity formation further suggested that the vision deficits in some Alzheimer's patients could be an ophthalmic pathology, rather than cognitive confusion and brain deterioration. CD screening for these patients might help in the design of better therapeutic interventions to improve their quality of life. 

Next, we investigated whether Aβ aggregation could be inhibited by TMAO. Chemical chaperoning is known to stabilize proteins, reduce their aggregation, and improve their cellular trafficking, leading to cell survival and correction of tissue defects. ^67–69 Although the exact mechanisms are still not defined, chemical chaperones likely stabilize the native folding equilibrium of substrate proteins, reduce nonproductive aggregation, or enhance the resident chaperoning environment. This has been demonstrated in correction of various misfolded proteins associated with pathological conditions and renders the chaperone-assisted protein rescue a tempting strategy for the management of protein conformational diseases. ^70–74 Removal of aberrant protein aggregates thus could reduce cellular and tissue toxicity and enhance tissue function. ^70,75,76 Our work illustrated that TMAO dose-dependently reduced the Aβ aggregation caused by Arg-124 TGFBI mutants. This was evidenced by suppressed levels of Aβ aggregates by WB, and reduced Aβ fibrillar structure containing β-sheet conformation by Congo red assay and by TEM. 

TMAO has been shown to stabilize proteins against the action of urea and hydrostatic pressure. ⁷⁷ This protein stabilization effect could be due to its hydrophobic nature to propel water molecules to the surface of proteins and increase their hydration capacity. The Gibbs free energy between native and denatured states becomes larger and this drives the equilibrium toward a more native state. ⁷⁸ This might further reduce the solvent-accessible surface area and induce the peptide to adopt a tighter conformation and restrict the mobility between protein domains, leading to a stabilized conformation and oligomeric assembly. 

In conclusion, our study confirmed the tight genotype-phenotype relationship of TGFBI gene-linked CDs. Chinese CD patients share a similar causative effect of TGFBI mutations for various CD subtypes as other ethnic populations. We also demonstrated that Aβ peptide aggregate formation was accelerated by the amyloidogenic Arg-124 mutants, when compared with WT or the Arg-555 mutants. This is a novel screening method for comparing the amyloidogenicity of TGFBI mutants. Furthermore, Aβ peptide aggregate formation by Arg-124 mutant TGFBIp could be alleviated by TMAO. Our findings provide a basis for a novel chemical-based strategy to treat this protein aggregation disorder and improve visual function. 

Footnotes

 Supported by General Research Fund 478609 and Lim Por Yen Eye Foundation Endowment Fund, Hong Kong.

Footnotes

 Disclosure: G.H.-F. Yam, None; K. Wang, None; V. Jhanji, None; K.-W. Choy, None; L. Baum, None; C.-P. Pang, None