Molecular Characterization of the Cystine/Glutamate Exchanger and the Excitatory Amino Acid Transporters in the Rat Lens

Abstract

purpose. To determine whether the cyst(e)ine/glutamate exchanger (X_C ⁻) and the excitatory amino acid transporters (EAAT1 to -5) are expressed in the rat lens.

methods. A combination of molecular-based and immunocytochemical strategies was used to screen for the presence of the light-chain subunit of X_C ⁻ (xCT) and the five known EAAT isoforms in the rat lens. An initial molecular profiling of xCT and EAAT1 to -5 expression was achieved by reverse transcription–polymerase chain reaction (RT-PCR). The presence of transporter proteins was verified by Western blot analysis and immunocytochemistry.

results. Transcripts for xCT and EAAT1 to -5 were detected by RT-PCR in lens fiber cells. Western blot analysis confirmed the expression of xCT and all five EAAT isoforms at the protein level. Immunocytochemistry revealed xCT expression to be present throughout the lens. Notably, changes in the subcellular distribution of xCT were shown to occur as a function of fiber cell differentiation. In the outer cortex, xCT labeling was predominantly cytoplasmic but progressively became more membranous with distance into the lens, due to xCT insertion into the broad sides of fiber cells. In the core, xCT labeling was localized around the entire membrane of inner fiber cells suggesting a redistribution of the exchanger. In contrast, EAAT expression was restricted to the outer cortex of the lens, with EAAT4/5 shown to be the predominant isoforms in cortical fiber cells. Western blot analysis of crude fiber membranes dissected from the outer cortex, inner cortex, and core region of the lens confirmed the presence of xCT in all three of these regions and demonstrated that EAATs were absent from the core region.

conclusions. The molecular identification and localization of xCT and EAAT1 to -5 in the lens raises the possibility that in the outer cortex X_C ⁻ and EAAT4/5 may work together to accumulate cysteine for GSH synthesis. The presence of xCT and the absence of the EAATs in the center of the lens suggest that X_C ⁻ could operate with an alternative glutamate uptake pathway to accumulate cysteine where it can potentially act as a low-molecular-mass antioxidant.

Old age cataract is associated with protein modifications brought about by oxidative damage to the lens. The young lens is protected from such damage through a robust oxygen radical scavenger system that is essential in the detoxification of reactive species and vital for maintaining lens transparency. ¹ With advancing age, the ability of this system to protect the lens from oxidative damage is reduced, ultimately resulting in opacification of the lens and the formation of old age cataracts. ² The principal component driving this system is the antioxidant glutathione (GSH). GSH acts specifically by protecting the thiol groups of proteins and minimizing disulfide bond cross linkages. ¹ With increasing age, the levels of GSH in the lens decrease and this decline increases the susceptibility of lens proteins to damage by oxygen species. ²  

The lens is supplied with GSH via two main pathways. The first is by uptake of circulating GSH by Na⁺-dependent or -independent transport mechanisms. ^{3 4} The second pathway involves endogenous biosynthesis of GSH in the lens cortex region. ⁵ Studies have shown GSH levels to be highest in the epithelial cell layer and outer cortex region. ¹ The reasons for the decrease in GSH levels with increased age are likely to be changes in GSH synthesis and/or GSH transport systems. However, studies by Rathbun and Bovis ⁶ demonstrated that alterations in GSH synthesis were an unlikely cause for the decreased levels of GSH. Although the specific activities of GSH synthesis enzymes were reduced with increased lens age, these reductions were insufficient to be responsible for the decrease in GSH levels. ⁶ Therefore, alterations in the transport of GSH or its precursor amino acids are likely to play contributing roles in the changes of GSH levels in older lenses. 

GSH is a tripeptide synthesized from cysteine, glutamate, and glycine by the sequential actions of the enzymes γ-glutamylcysteine synthetase and glutathione synthetase. ^{5 7} Cysteine has been identified as the rate-limiting substrate for GSH biosynthesis in the brain, liver, and pancreas. ^{8 9} In the lens, low levels of GSH synthesis are associated with a concomitant decrease in the cytoplasmic cysteine levels. Cysteine levels in the lens are controlled via the transsulfuration pathway ¹⁰ and via direct uptake from the aqueous humor. ^{11 12} Although the transsulfuration pathway has been recently defined in the lens, little is known about the molecular identity of cysteine uptake. A close relationship between cysteine and glutamate uptake has been identified in the brain through the actions of the cyst(e)ine/glutamate exchanger (X_C ⁻) and the high-affinity glutamate transporter family (X_AG) ¹³ (Fig. 1) . By a combination of immunolocalization and inhibitor-based studies, these two systems have been demonstrated to work together to mediate cysteine uptake for GSH synthesis in the brain. ^{13 14} The driving force behind the accumulation of cysteine in the brain is the X_C ⁻ exchanger. The X_C ⁻ system mediates the Na⁺-independent exchange of extracellular cystine (the oxidized form of cysteine) for intracellular glutamate. ¹⁵ The accumulated cystine is rapidly reduced to cysteine which is incorporated into proteins or glutathione. ¹⁶ In the lens, free cysteine has also been proposed to act as a powerful low-molecular-mass antioxidant. ² X_C ⁻ is a heterodimeric exchanger consisting of a heavy and a light chain subunit. The light chain, known as xCT, confers substrate specificity; whereas the heavy chain, formed by the cell surface antigen 4F2hc interacts with different light chains to form other heterodimeric amino acid transporter systems. ¹⁷  

Inherent in the functioning of X_C ⁻ is the maintenance of an outwardly directed glutamate concentration gradient. This active accumulation of glutamate in the brain is mediated by members of the X_AG family, collectively known as excitatory amino acid transporters (EAATs), which act to clear rapidly from the synaptic cleft the glutamate released from glutamatergic neurons. ¹⁸ In astrocytes this glutamate can serve as a substrate for GSH synthesis, can be converted to glutamine for export to presynaptic neurons, or can be used by X_C ⁻ to drive cystine uptake (Fig. 1) . There are five members of the EAAT family, designated EAAT1/GLAST, ¹⁹ EAAT2/GLT1, ²⁰ EAAT3/EAAC1, ²¹ EAAT4, ²² and EAAT5. ²³ These transporters are Na⁺-dependent and exhibit cell-type–specific expression. ^{23 24 25 26 27} EAAT1 and -2 are localized to glial cells, EAAT3 and -4 to neurons, and EAAT5 primarily to the retina. ^{20 21 22 23 24 27} All isoforms mediate the active accumulation of glutamate via the cotransport of two to three sodium ions, a proton and the countertransport of a potassium ion. ²⁸ Studies have shown that glutamate transport elicits an associated chloride conductance that varies in magnitude across subtypes. ²³ The ion channellike properties and differential localization of these isoforms suggest functional diversity for members of the EAAT family. ²⁹  

To determine whether these neuronal cysteine and glutamate transporters are also expressed in the lens, we screened for xCT and members of the EAAT family by RT-PCR and Western blot analysis and localized their expression by immunocytochemistry. Our results indicate that all candidate transporters are expressed in a differentiation-dependent manner, suggesting that regional differences in amino acid uptake may exist in the rat lens. 

Materials and Methods

Reagents

The amino terminal tail-specific xCT antibody was purchased from TransGenic, Inc. (Kumamoto, Japan). Isoform-specific EAAT antibodies raised against either the carboxyl (EAAT1, -3, -4, and -5) or amino terminal tails (EAAT2), and their corresponding control peptides, were all obtained from Alpha Diagnostic International (San Antonio, TX). Phosphate-buffered saline (PBS) was prepared from PBS tablets (Sigma-Aldrich, St. Louis, MO). Unless otherwise stated, all other chemicals were from Sigma-Aldrich. 

Animals

All animals were treated according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Twenty-one-day-old Wistar rats were killed by CO₂ asphyxiation and the eyes removed. Lenses were extracted from the globe and placed in PBS. Lenses for RNA extraction and protein purification were rolled on sterile filter paper to remove any adherent tissues and were decapsulated with sharpened forceps, to remove the epithelial cells from the fiber cells. 

Reverse Transcription–Polymerase Chain Reaction

Decapsulated lenses were placed in tissue storage reagent (RNAlater; Invitrogen, Carlsbad, CA) before total RNA isolation. Total RNA was isolated with extraction reagent (TriZOL; Invitrogen-Gibco, Grand Island, NY) according to the manufacturer’s protocol. Genomic DNA was removed from the total RNA before cDNA synthesis, with a 20-minute incubation at 20°C with 0.1 U/μL DNase I (Roche Molecular Biochemicals, Basel, Switzerland). mRNA was purified (QuickPrep Micro mRNA Purification Kit; Amersham Biosciences, Piscataway, NJ). First-strand synthesis and cDNA amplification were performed (ThermoScript RT-PCR system; Invitrogen). cDNA was synthesized from 1 μg RNA with 5 μM oligo(dT)₂₀ in 10-μL final reaction volumes. The RNA was denatured at 65°C for 5 minutes and then placed on ice to cool before adding 10 μL of the following mix to give final concentrations of 1× cDNA synthesis buffer, 0.5 mM dithiothreitol (DTT), 1 mM dNTPs (dATP, dTTP, dCTP, and dGTP) and 15 U/μL reverse transcriptase (Invitrogen). A control reaction (no cDNA synthesis) was also conducted in the absence of reverse transcriptase. Synthesized cDNA (1 μL) or control reaction (1 μL) were added to separate PCR mixtures. The reaction mixture contained 1× PCR buffer, 1 mM MgCl₂, 0.2 mM dNTPs, 0.05 U/μL polymerase (Platinum Taq DNA; Invitrogen) and 0.2 μM sense and antisense primers from the primer sets listed in Table 1 . The DNA polymerase was heat activated at 94°C for 10 minutes before PCR cycling. Amplification was performed with a 30-second period of denaturation at 94°C, a 30- to 60-second annealing step at 55°C, a 30- to 60-second extension at 72°C, and a final 10-minute extension at 72°C, to optimize ligation conditions. Amplified PCR products were analyzed by electrophoresis on 0.8% agarose gels and subsequently cloned and sequenced. The primer sets and the expected sizes of PCR products are listed in Table 1 . 

Western Blot Analysis

Total crude fiber membranes were prepared from decapsulated lenses homogenized in 5 mM Tris-HCl, 5 mM EDTA, and 5 mM EGTA (pH 8.0). The homogenate was repeatedly washed by centrifugation at 12,000 rpm for 20 minutes. The pellet was resuspended in storage buffer (5 mM Tris [pH 8.0], 2 mM EDTA, and 2 mM EGTA) and the resultant membranes stored at −20°C until further use. Crude fiber membranes from the outer cortex, inner cortex, and inner core of the lens were also prepared from 10 to 15 decapsulated lenses with a microscope and a pair of sharpened tweezers. The superficial layers of fiber cells were peeled away and pooled as the outer cortex fraction. The remaining inner cortical fiber cells were removed to reveal a hard mass that corresponded to the inner core of the lens. All three fractions were homogenized, washed, and stored as outlined for the preparation of total crude fiber membranes. The concentration of lens membranes was determined with the BCA detection kit (Pierce, Rockford, IL). Proteins were separated on a 10% sodium dodecyl sulfate-polyacrylamide gel and transferred to a nitrocellulose membrane by electrophoresis for 40 minutes at 170 mA. The membrane was incubated with blocking solution (5% milk in 1× Tris-buffered saline [TBS], 2 mM Tris-HCl, 140 mM NaCl [pH 7.6]) at room temperature for 1 hour. xCT and the EAATs were detected with commercially available affinity-purified antibodies. The protein blots were incubated overnight with 2 μg/mL primary antibody in 1% BSA-TBS, followed by incubation with biotinylated secondary antibody (1:1000; Amersham Biosciences), and streptavidin-HRP (1:2000; Amersham) for 1 hour each. After each incubation, the membrane was washed six times for 5 minutes in 1× TBS. Labeled protein was visualized by chemiluminescence detection (ECL; Amersham) and exposure on film (Hyperfilm; Amersham). Control peptide studies were also performed to demonstrate antibody specificity. EAAT1 to -5 antibodies (2 μg/mL) were preabsorbed with a 20-fold excess of their corresponding control peptides according to the manufacturer’s instructions (Alpha Diagnostics International). There were no xCT control peptides commercially available. 

Immunocytochemistry

Whole lenses were fixed for 24 hours in 0.75% paraformaldehyde in PBS and then cryoprotected by incubation in 10% sucrose-PBS for 1 hour, 20% sucrose-PBS for 1 hour, and 30% sucrose-PBS overnight at 4°C. For sectioning, whole lenses were mounted in an equatorial orientation on prechilled chucks and encased in optimal cutting temperature compound (Tissue-Tek; Sakura Finetek, Torrance, CA). Lenses were cryosectioned into 16-μm-thick sections and transferred onto poly-l-lysine-coated microscope slides (Superfrost Plus; Electron Microscopy Sciences, Fort Washington, PA). Sections were washed three times in PBS and then incubated in blocking solution (3% BSA and 3% normal goat serum [NGS]) for 1 hour to reduce nonspecific labeling. The sections were then labeled with 4 to 8 μg/mL primary antibody in PBS, followed by secondary fluorescein-conjugated antibody (1:200; Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour each. Control sections omitting primary antibody and with primary antibody incubated with a control peptide were also prepared. Cell membranes were also labeled with a tetramethylrhodamine isothiocyanate (TRITC)-conjugated wheat germ agglutinin (TRITC-WGA). The TRITC-WGA was diluted 1:50 in PBS, and the sections were incubated for 1 hour. After extensive washing in PBS, sections were mounted in antifade reagent (Citifluor; AFI, Canterbury, UK) and viewed with a confocal laser scanning microscope (TCS 4D; Leica, Heidelberg, Germany). Images were pseudocolored and combined by image-analysis software (Photoshop; Adobe Systems, Mountain View, CA). 

Results

Molecular Identification of xCT and EAATs in Lens Fiber Cells

Because the heavy chain of X_C ⁻ is known to interact with different light chains, such as LAT1, y+LAT1, y+LAT2, and ASC1 to form other heterodimeric amino acid transport systems, ¹⁷ PCR primers were specifically designed against xCT (Table 1) , the light chain of the dimeric X_C ⁻ exchanger. ¹⁶ A PCR product of the predicted size was obtained from brain and lens fiber mRNA. The product was sequenced and found to correspond to the xCT sequence contained in GenBank, thereby establishing xCT to be present at the transcript level in the lens (Fig. 2A) . To determine whether xCT is also expressed at the protein level, Western blot analysis was performed on membranes prepared from the brain and lens. In the brain, multiple bands were detected, whereas, in the lens, two bands at 55 and 110 kDa were detected (Fig. 2B) . The size of the 55-kDa band is consistent with published reports, ¹⁶ and the 110-kDa band may represent a dimerized form of xCT. Collectively, these results demonstrate the xCT exchanger to be present at both the transcript and protein levels in rat lens fiber cells. 

In the brain, X_C ⁻ is known to work with the EAATs to accumulate cystine in exchange for glutamate. To determine whether the EAATs were present in the lens, PCR primers were designed against regions that were highly divergent among these transporter isoforms to ensure amplification was specific for a particular EAAT isoform (Table 1) . PCR products for EAAT1 to -5 of the predicted size was obtained from lens fiber cell mRNA and control tissues (Fig. 3A) . The products were sequenced and were found to be identical with the corresponding segments of the sequences contained in GenBank, confirming all the EAAT isoforms to be present at the transcript level in the lens. To verify EAAT expression at the protein level, Western blot analysis was performed with isoform-specific EAAT antibodies. In the brain, the different isoforms exhibited multiple bands which ranged in molecular mass from 55 to 120 kDa (Fig. 3B) . This heterogeneity in size appears to be a characteristic feature of all members of the EAAT family, ^{24 30 31} and has been attributed to a combination of aggregation, differential glycosylation, proteolysis, and variations in membrane preparation. ³² These observations are supported in the present study by the ability of control peptides to knock down the majority of these heterogenic bands in the brain, indicating that the antibodies used specifically detect their respective EAAT isoforms. In contrast to the brain, EAAT isoforms expressed in the lens exhibited less heterogeneity in transporter size, producing a tight cluster of bands in the 50- to 60-kDa range. Single bands in this range were detected for EAAT1, -2, and -3 that were able to be knocked down when these antibodies were preabsorbed with their corresponding antigenic peptides. In addition to this band, additional bands were identified for EAAT4 and -5, some of which could not be knocked down by their corresponding antigenic peptides. Taken together, the evidence appears to show that the 50- to 60-kDa bands identified in the lens are specific for individual EAAT subtypes and are not artifactual. The reduced heterogeneity of EAAT sizes in the lens compared to the brain indicates that the processes responsible for posttranslational modification of the EAAT family in the two tissues are different. 

In summary, we have identified xCT and the EAATs at the transcript and protein level in the lens. Analogous to the brain, this finding suggests that these two transport systems may work together to accumulate cysteine in the lens. 

Localization of xCT and the EAATs in the Lens

For xCT and the EAATs to work together, we would expect them to colocalize at the cellular level. Ideally, this could be achieved by double-labeling experiments. Unfortunately, all the antibodies available were raised in rabbits, making this experimental approach unfeasible. To circumvent this, we performed immunocytochemical labeling on cryosections obtained from the lens equator that were double-labeled with either xCT or EAAT isoform-specific antibodies, and the membrane marker WGA. Sections were imaged to obtain high-resolution maps for each transporter and overlapping expression patterns for xCT and EAATs identified. Mapping of xCT showed the exchanger to be differentially distributed throughout the whole lens (Fig. 4) . In peripheral fiber cells, labeling for xCT was predominantly cytoplasmic, although punctate labeling of the membrane was observed (Fig. 4B) . In addition, labeling of the cytoplasm and basolateral membrane was observed in the epithelium (Fig. 4B , inset). With increasing depth into the lens, a decrease in the cytoplasmic signal was seen that coincided with an increase in the membrane labeling (Figs. 4C 4D 4E) . Closer examination of this membrane labeling of deeper fiber cells revealed that xCT localized initially to the broad sides of fiber cells, forming plaque-like structures (Figs. 4C 4D) , but in the core region of the lens xCT labeling was uniformly distributed around the entire fiber membrane, suggesting a redistribution of the exchanger (Fig. 4E) . A similar pattern of redistribution has been observed in gap junction channels ³³ and may reflect a posttranslational modification of xCT or associated proteins. 

Similar high-resolution mapping of the EAATs throughout the lens diameter revealed that immunocytochemical labeling of all five EAAT isoforms was restricted to the outer cortex region of the lens (Fig. 5) . A feature of immunolabeling with the EAAT antibodies was the presence of variable patterns of cytoplasmic labeling throughout the outer cortex. These isoform-specific labeling patterns were knocked down by either omitting the primary antibodies or the preabsorption of antibodies with their corresponding antigenic peptides (data not shown). In addition to this cytoplasmic labeling, all the EAAT isoforms exhibited distinct membrane localizations. In peripheral cortical fiber cells, EAAT1 was shown to colocalize with cell membranes (Fig. 5A) . However, out of all the EAAT isoforms EAAT1 labeling was the weakest. In the extreme periphery of the lens, EAAT2 associated with the basolateral membrane of the epithelium (Fig. 5B) , whereas EAAT3 membrane labeling was strongest at the apical–apical interface located between the epithelial and fiber cells (Fig. 5C) . Strong labeling for EAAT4 was detected throughout the lens cortex, and the membrane labeling for this isoform was predominantly located on the narrow sides of fiber cells (Fig. 5D) . EAAT5 labeling was restricted to a narrow band in the outer cortex. It was not expressed in peripheral fiber cells and only became apparent in a restricted zone that started ∼50 μm away from the capsule and was maintained for a further ∼50 μm before labeling disappeared. In this zone, EAAT5 was shown to associate with membranes although this labeling was not as strong as that seen for EAAT4 (Fig. 5E) . Finally, for all five isoforms no labeling was seen in either the inner cortex or core of the lens (Fig. 5F) . 

Taken together our immunocytochemical findings suggest regional differences in the expression of xCT and EAAT isoforms exist. To confirm this, Western blot analyses of the outer cortex, inner cortex, and core regions of the lens were performed (Fig. 6) . xCT was found to be expressed in all regions as suggested by our immunocytochemistry results (Fig. 6A) . As expected, all the EAATs were restricted to cortical fractions and were absent from the lens core (Fig. 6B) . Consistent with our immunolabeling results, EAAT2 and -5 were restricted to the outer cortex, whereas the strong signal observed for EAAT4 indicates that EAAT4 may be the predominant isoform in cortical fiber cells. The overlapping expression patterns of xCT and a subset of the EAATs (EAAT4/5) raises the possibility that these transporters are capable of working together to mediate uptake of cysteine, at least in the outer cortex of the lens. 

Discussion

Because the X_C ⁻ exchanger and the EAATs have been shown to work together in the brain to supply cells with cysteine for GSH synthesis, we wanted to investigate whether a similar system was also used by the lens. As a first step toward this goal we used a combination of molecular techniques to show that xCT and EAAT1 to -5 exhibit distinct expression patterns that correlate with fiber cell differentiation. Furthermore in the outer cortex, an area known to be involved in GSH synthesis, xCT and the EAATs were shown to colocalize, suggesting that they may play a role in maintaining the antioxidant balance in the lens. 

The differentiation-dependent patterns of xCT and EAAT1 to -5 expression observed in the present study follow a general trend that our group has observed in a variety of membrane proteins. ³⁴ The initial accumulation of xCT in the cytoplasm of peripheral fiber cells followed by its insertion into the membrane, mirrors that of the glucose transporter GLUT3 ³⁵ and the adhesion protein MP20. ³⁶ Since fiber cells have a limited ability to synthesize membrane proteins because of the degradation of cellular organelles and nuclei, ³⁷ we hypothesized that young fiber cells produce a cytoplasmic store of membrane proteins that can be inserted into the membranes at a later stage in the process of fiber cell aging and differentiation, thereby circumventing the inability of older fiber cells to synthesize membrane proteins de novo. ³⁴ Similarly, the redistribution of xCT from the broad sides of cortical fiber cells to around the entire membrane of inner fiber cells parallels the changes we have observed previously in the subcellular distribution of gap junctions. ³³ It is our view that the lens uses a combination of differential expression, membrane insertion, and posttranslational modifications in the absence of nascent protein synthesis to fine-tune membrane protein composition for operation in different regions of the lens. 

In the present study we have observed that all five EAATs are differentially expressed in the lens. The expression of multiple EAAT isoforms is not unique to the lens. Other studies have shown all the EAAT isoforms to exist in the retina and multiple EAAT isoforms to be present in the brain. ^{19 20 21 22 23 38} However, notable differences were observed in their localization, kinetic properties, ³⁹ associated chloride conductances, ^{23 29} and ability to accumulate cysteine, ^{40 41 42} indicating functional diversity between the EAAT isoforms. This suggests that the differential expression of EAAT isoforms observed in the lens may produce functionally distinct regions of glutamate uptake. 

With this view in mind, we combined our present molecular results with previous biochemical and uptake studies (Veltman J, et al. IOVS 1993;34:ARVO Abstract 285) ^{2 5 43} to develop a working model that depicts the possible roles played by X_C ⁻ and the EAATs in the uptake of cysteine and the synthesis of GSH in different regions of the lens. In the epithelium, we found that xCT and EAAT2 were predominantly located in the basolateral membrane, whereas EAAT3 was located in the apical membrane. EAAT2 and -3 have also been shown to mediate cysteine uptake in addition to the uptake of glutamate, indicating that these transporters may play a role in providing both precursor amino acids for GSH synthesis in the epithelial cells. Fiber cells in the outer cortex express xCT and the EAATs, of which EAAT4 and -5 appear to predominate. This overlap in the expression patterns of xCT and EAAT4/5 suggests that these transporters work together to facilitate the accumulation of cysteine in the outer cortex of the lens (Fig. 7) . Previous biochemical studies have characterized the GSH synthesizing enzymes ⁶ and have shown that the primary source of glutamate for GSH synthesis occurs via the uptake of glutamine ^{44 45} and its subsequent conversion to glutamate. ^{46 47} Thus the concentration of glutamate is higher in the cytoplasm than in the extracellular space (16.5-fold difference), creating a glutamate concentration gradient ⁴⁷ that is used by xCT to mediate the uptake of cyst(e)ine. We envisage that this cycle of cyst(e)ine/glutamate exchange is maintained by the subsequent active removal of glutamate from the extracellular space by the EAATs, using energy provided by the Na⁺-gradient. 

Thus, the primary role of the EAATs in the lens may differ slightly from that of the EAATs in the brain, which is to remove glutamate from the synaptic cleft, terminating synaptic transmission and preventing neurotoxicity (Fig. 1) . Because glutamate concentrations in the aqueous humor are normally low, we believe the primary role of these transporters in cortical fiber cells is to maintain the glutamate concentration gradient necessary for cyst(e)ine/glutamate exchange. Overall, the activity of X_C ⁻ and the EAATs in the outer cortex produces an accumulation of cysteine, the rate-limiting substrate for the synthesis of the tripeptide GSH. For completeness, we have included in our model an uptake mechanism for the other precursor peptide, glycine. The molecular identification of glycine and glutamine transporters in the lens will be the focus of future studies. 

Although we found xCT to be expressed in the lens core, we found no expression of EAATs in this region, indicating that mature fiber cells operate a different cysteine uptake system from that used by younger fiber cells. Although we have no evidence to show that xCT is functional in the core, others have shown that cysteine is elevated in the core relative to the cortex (Veltman J, et al. IOVS 1993;34:ARVO E-Abstract 758), ^{2 43} suggesting an active cysteine uptake pathway exists. This raises three questions. First, if xCT is responsible for this accumulation of cysteine in the core, then what transporter mediates recycling of glutamate to drive cyst(e)ine/glutamate exchange? A promising candidate to work with X_C ⁻ in the center of the lens is the neutral amino acid transporter ASCT2. Studies have shown glutamate transport activity via ASCT2 to be enhanced at low pH, ⁴⁸ which coincides with the acidic environment observed in the lens core. Alternatively, we cannot rule out the possibility that the EAATs may work with X_C ⁻ in this region but may be undetectable by our antibodies through either loss or masking of an epitope as a result of protein degradation or posttranslational modifications. Second, why are the levels of cysteine in the lens core higher than in the cortex? This could be due to either a stimulation of cysteine uptake, a decrease in incorporation of cysteine into GSH, or both. Obviously, to address these questions, further functional studies are needed that focus on cysteine uptake and GSH synthesis in the core of the lens. Third, what is the role of high levels of free cysteine in the core? It has been proposed that cysteine can act directly as a low-molecular-mass antioxidant to protect cells from oxidative damage. ²  

In summary, we have combined our molecular results with previous results on amino acid uptake and concentrations in the lens, to produce a working model that depicts the roles of amino acid transporters in the protection of the lens against oxidative damage. Identifying the additional transporters involved in GSH synthesis in the cortex and cysteine accumulation in the core and determining which components of this model are most at risk during the onset of lens cataract will be the focus of ongoing work. 

 Supported by the Health Research Council of New Zealand, the Marsden Fund, and the University of Auckland Research Committee.

 Submitted for publication February 6, 2005; revised March 17, 2005; accepted April 9, 2005.

 Disclosure: J. Lim, None; Y.C. Lam, None; J. Kistler, None; P.J. Donaldson, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Figure 1.

 

Cysteine and glutamate uptake in the brain. Glutamate released from glutaminergic neurons (1) is taken up by astrocytes through the EAATs. Glutamate can then be either incorporated into GSH (2), converted to glutamine for subsequent export to neurons (3), or used by X_C ⁻ (4) to facilitate cyst(e)ine accumulation. Glutamate removed by X_C ⁻ is subsequently cycled back into the astrocytes through the EAATs (5), thereby maintaining the glutamate gradient necessary for cyst(e)ine/glutamate exchange.

Table 1.

 

PCR Primer Sets and Predicted Product Size

Protein	Oligonucleotide	Expected PCR Product Size (bp)
xCT (light chain) (GenBank Acc. No. AB022345)	Sense (21 b, position 748) CCTGGCATTTGGACGCTACAT	184
		Antisense (22 b, position 929) TCAGAATTGCTGTGAGCTTGCA
EAAT1 (GenBank Acc. No. X63744)	Sense (23 b, position 1162) TCTTGGTTTCGCTGTCTGCCACG	656
			Antisense (24 b, position 1815) TCCTCATTCATGCCGTCATCGTCC
EAAT2 (Genbank Acc. No. X67857)	Sense (25 b, position 1311) ATGTCTTCGTGCATTCGGTGTTGGG	328
			Antisense (23 b, position 1636) AGCCGTGGCACCATCTTCATAGC
EAAT3 (Genbank Acc. No. U39555)	Sense (22 b, position 1176) AGCCGTGGCACCATCTTCATAGC	377
			Antisense (25 b, position 1529) TCGGCAACCCTTCCAGTTACATTCC
EAAT4 (GenBank Acc. No. U89608)	Sense (25 b, position 1769) GCTTGTGCCATGAGTGACTTATAGG	784
			Antisense (22 b, position 1012) CGTGTCCTGAGGGATTTCTTCG
EAAT5 (Genbank Acc. No. U76362)	Sense (20 b, position 251) CCTGTCTGTGCTGTCTGTCA	756
			Antisense (20 b, position 985) AATGCCGAAGGGGAAATACC

Figure 2.

 

Expression of xCT transcript and protein in rat lens fiber cells. (A) Agarose gel showing a 200-bp RT-PCR product amplified from brain (B) and lens fiber mRNA (F+) obtained using xCT primers. No PCR product was seen in a control reaction using fiber cell mRNA in which reverse transcriptase was omitted (F−). L refers to the 1-kb DNA ladder. (B) Western blot analysis with an xCT antibody identified multiple bands in membranes prepared from the brain (B), including a prominent band at 55 kDa, which is characteristically xCT. In lens fiber cell membranes (F), bands at 55 and 110 kDa were identified.

Figure 3.

 

Expression of EAAT transcripts and proteins in rat lens fiber cells. (A) Agarose gel showing RT-PCR products obtained from brain (B), retina (R), and lens fiber cell (F+) mRNA by using specific primers for the five EAAT isoforms. No PCR product was seen in a control reaction using fiber cell mRNA in which reverse transcriptase was omitted (F−). L refers to the 1-kb DNA ladder. (B) Western blot analysis using either EAAT1 to -5 antibodies or EAAT1 to -5 antibodies preabsorbed with their corresponding antigenic peptides (CP). In control tissues, a characteristic heterogeneity of bands that ranged between 55 and 120 kDa were seen for the EAATs. In lens fiber membranes (F), there were bands ranging between 50 and 60 kDa for all EAAT isoforms. Preabsorption of antibodies with their corresponding antigenic peptides knocked down labeling of most bands, in both control and lens fiber cell preparations.

Figure 4.

 

Localization of xCT in different regions of the rat lens. Equatorial cryosections double labeled with xCT antibodies (green) and the membrane marker WGA (red). (A) Montage of extended confocal images of a lens section labeled with WGA extending from the outer cortex to the core region. Boxes: areas from which high-magnification images were recorded. (B) In peripheral fiber cells, xCT labeling was predominantly cytoplasmic. Labeling was also observed in the cytoplasm and basolateral membrane of the epithelium (inset). (∗) Nuclei in peripheral fiber cells that appear to be more intensely labeled by the xCT antibody. Cp, capsule; Ep, epithelium; F, fiber cells. (C, D) In deeper-lying fiber cells, xCT labeling was primarily membranous, with xCT colocalized to the broad sides of fiber membranes. (E) In the core region, xCT labeling was almost uniform around the entire membrane.

Figure 5.

 

Differential expression patterns of EAATs in the outer cortex of the rat lens. Equatorial cryosections double-labeled with isoform-specific EAAT antibodies (green) and the membrane marker WGA (red). Although all EAAT isoform labeling was restricted to the outer cortex, the labeling patterns differed for each isoform. (A) EAAT1 labeling was observed throughout the outer cortex and appeared predominantly as punctate cytoplasmic labeling (inset). (B) EAAT2 labeling was most intense in the epithelial cell layer, where it localized to the basolateral membrane and cytoplasm of the epithelial cells (inset). (C) Although some labeling for EAAT3 was detected in fiber cells, the most intense labeling was observed at the interface between epithelial and fiber cells (inset). (D) A strong and diffuse labeling pattern was observed for EAAT4, which appeared within the first 50 μm from the capsule. Some of this labeling colocalized with the narrow sides of peripheral fiber cells (inset). (E) EAAT5 labeling was initially absent from peripheral fiber cells and became apparent only in a zone that started within 50 μm from the capsule. In this region, the labeling was cytoplasmic with some labeling apparent on the membrane (inset). (F) A representative image taken from the core of the lens to illustrate the absence of EAAT labeling in this region. The image shown is of EAAT1. Similar results were obtained for the other EAAT isoforms.

Figure 6.

 

Verification of regional differences in xCT and EAAT protein expression in the rat lens. Membrane preparations obtained by dissection of the lens into outer cortex (OC), inner cortex (IC), and core (C) fractions were analyzed by Western blot analysis using either xCT (A) or EAAT isoform-specific antibodies (B). (A) Protein bands for xCT were observed in all three fractions. (B) All the EAATs were restricted to the cortical fractions and were absent from the core.

Figure 7.

 

Working model of the roles X_C ⁻ and the EAATs play in the uptake of cysteine and the synthesis of GSH in the outer cortex of the lens. In this region, the coexpression of xCT and the EAAT4/5 indicate that these transporters may work together to accumulate cysteine. The X_C ⁻ exchanger uses the high-glutamate concentration gradient to drive the exchange of extracellular cyst(e)ine for intracellular glutamate. This cycle of cyst(e)ine/glutamate exchange is maintained by the EAATs, which actively remove glutamate from the extracellular space. (1) The primary source of glutamate for GSH synthesis is believed to be derived from glutamine uptake and its subsequent conversion to glutamate. (2) An uptake mechanism for glycine, the third precursor amino acid required for GSH synthesis, has also been included in our model.

The authors thank Marc Jacobs for advice and constructive discussions.