Role of β-Adrenergic Receptors in Inflammatory Marker Expression in Müller Cells

Robert J. Walker; Jena J. Steinle

doi:10.1167/iovs.07-0129

Abstract

purpose. To determine whether β-adrenergic receptors are involved in the modulation of inflammatory cytokines in Müller cells in a hyperglycemic environment.

methods. Rat Müller cells were grown in high (25 mM)- or low (5 mM)-glucose medium. Müller cells lysates were processed for real-time polymerase chain reaction to measure steady state mRNA expression for the following inflammatory markers: iNOS, TNF-α, IL-1B, and ICAM-1. Western blot analysis and ELISA assays were performed to determine the protein levels of these inflammatory markers and PGE2 content.

results. Isoproterenol treatment significantly decreased protein levels of iNOS, TNF-α, and IL-1B, in rMC-1 cells cultured in high glucose as early as 1 hour, compared with cells receiving no treatment. PGE2 content was also reduced after isoproterenol treatment. There were no significant changes observed in protein levels of ICAM-1 production after isoproterenol treatment in high glucose. Steady state mRNA levels for iNOS were significantly decreased 1 hour after isoproterenol, whereas ICAM-1 gene expression was significantly increased after 1 hour. Isoproterenol significantly increased gene expression for IL-1B after 24 hours of treatment.

conclusions. These results suggest that stimulation of β-adrenergic receptors with isoproterenol leads to decreased levels of PGE₂, TNF-α, and IL-1B protein content, and in both gene expression and protein levels of iNOS in Müller cells cultured in hyperglycemia. β-Adrenergic receptor agonists had limited effects on ICAM-1 protein production. These results indicate that isoproterenol treatment reduces cytokine activation in cultured rat Müller cells.

Diabetic retinopathy is the leading cause of blindness in working-age adults.¹It is estimated that each year between 12,000 and 24,000 people lose their sight because of this disease.²Several studies have suggested that inflammation may be one cause of some of the changes that occur in diabetic retinopathy.³ ⁴ ⁵ ⁶ ⁷ ⁸This finding suggests that changes in inflammation play an important role in the progression of diabetic retinopathy and that certain cytokines are possible mediators.

During the onset of diabetes, there is a loss of sympathetic nerve activity that takes place in different regions of the body.⁹Results in studies have suggested that sympathetic nerves are compromised in the eye as well. Specifically, loss of sympathetic nerves appears to influence basement membrane thickness and pericyte loss in the retina.¹⁰Recent publications have identified that another cell type in the retina may be susceptible to changes in sympathetic neurotransmission: Müller cells.³Müller cells serve as structural support cells in the retina and span its entire thickness.⁴Müller cells have been identified as having such roles as regulating blood flow in the retina and maintaining the blood–retinal barrier.⁷Previous findings have suggested that Müller cells demonstrate early changes after introduction of diabetic-like conditions.¹¹

In the retina, inflammatory markers are present in glial cells and endothelial cells and are significantly upregulated with the addition of high glucose. To investigate inflammatory marker expression in hyperglycemia, we focused on five specific inflammatory markers: TNF-α, interleukin (IL)-1B, inducible nitric oxide synthase (iNOS), intracellular adhesion molecule (ICAM)-1, and prostaglandin E2 (PGE2). Recently, cytokines have been implicated in the development of diabetic retinopathy.⁵ ¹²Studies of the blood–retinal barrier after exposure to various cytokines such as IL-1B, TNF-α, and ICAM-1 have shown proinflammatory effects in animals with experimental diabetes.⁷PGE2 has been thought to act on Müller cells, since sympathectomy produced increased PGE2 levels that were not produced by retinal endothelial cells exposed to hyperglycemia.³A study has also suggested that hyperglycemia plays an important role in the increase of NO via iNOS in cell death, specifically in Müller cells.¹¹

To determine whether sympathetic nerve modulation of increased inflammatory marker expression occurs in Müller cells cultured in hyperglycemia, rat Müller cells were grown in culture in both low- and high-glucose conditions. The main goal of the present study was to determine whether β-adrenergic receptors are present on rat Müller cells. A secondary goal was to determine whether stimulation of β-adrenergic receptor signaling would counter the upregulation of inflammatory markers observed in Müller cells cultured in hyperglycemic conditions.

Methods

Müller Cell Culture

Retinal Müller cells were kindly supplied by Vijay Sarthy (Northwestern University, Evanston, IL). Rat retinal Müller cells (rMC-1) were cultured and passaged in DMEM (Invitrogen, Carlsbad, CA) containing either 5 mM glucose (low glucose) or 25 mM glucose (high glucose) with 10% FBS. When the cells reached 80% confluence, they were starved, reducing the rate of proliferation by decreasing the concentration of FBS from 10% to 0% but replacing it with 0.1% bovine serum albumin in both 5- and 25-mM media. The cells are starved for 18 to 24 hours in either low- or high-glucose medium with 0% FBS, to ensure that they remained in the same glycemic environment. Immediately after starvation, they were treated with 10 μM isoproterenol dissolved into either the high- or low-glucose medium for periods of 1, 6, 12, 18, or 24 hours. A specific number of dishes were used as nontreated (NT) control cultures. The cells were harvested at each of the five time points and pelleted in either an RNA extraction agent (TriReagent; MRC, Inc., Cincinnati, OH) or lysis buffer (protein).

RNA Isolation and Reverse Transcription

RNA was isolated from rMC-1 cells treated with isoproterenol from each of the five time points and controls by using the extraction reagent, chloroform, and isopropanol. The purity of RNA was evaluated by measuring the concentration with a spectrophotometer and then detection by agarose gel electrophoresis. Appropriate RNA was reversed transcribed by using 1 μg of RNA for the synthesis of cDNA. The reverse transcription mixture contained diethyl pyrocarbonate (DEPC) water, 5× reaction buffer, 25 mM MgCl₂, 10 mM dNTP, and RNase inhibitor. Strands were extended for 60 minutes at 42°C, and the strands were inactivated for 15 minutes at 70°C. RNase A inhibitor was added for 30 minutes at 37°C. After this process, samples were stored at −20°C.

Real-Time Polymerase Chain Reaction Gene Analysis

Real-time PCR primers to identify the inflammatory markers TNF-α, IL-1B, iNOS, ICAM-1, and 18s rRNA (housekeeping gene) were designed by using the computer software, GCG Prime (Accelrys, Campbell, CA). All primers for real-time PCR were between 100 to 200 bp. The sequences of the PCR primer pairs (5′–3′) that were used for each gene are given in Table 1 . Real-time PCR reactions were performed with a PCR mix (iQSYBR Green Supermix, containing 100 mM KCl, 40 mM Tris-H, 0.4 mM of each dNTP, 50 U/mL DNA polymerase (iTaq), and 6 mM MgCl₂, SYBR Green I, 20 nM fluorescein, and stabilizers; Bio-Rad, Hercules, CA). Thermocycling was performed in a final volume of 25 μL (8 μL DEPC H₂O, 2 μL cDNA, 1.25 μL = 500 nM of each primer, and 12.5 μL of 2× iQ SYBR Green Supermix; Bio-Rad) under the PCR conditions of initial heating at 95°C for 300 seconds to denature cDNA and activate the Taq DNA polymerase, followed by 45 cycles consisting of denaturation at 95°C for 20 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 20 seconds with thermocycler (Smart Cycler; Cepheid, Sunnyvale, CA).

An additional step, a melting curve, was added to determine specificity. The melting curve was constructed by increasing the temperature from 60°C to 95°C with a temperature transition rate of 0.2°C/s. To ensure that the correct primer was properly amplified, all amplicons were verified by using 1.2% agarose gel electrophoresis, and no difficulty was noted in separating the primer size.

Western Blot Analysis

Cells stored in lysis buffer (1.58 g Tris base, 150 mL sterile water, 1.80 g NaCl, 20 mL 10% Igepal-40, 5 mL 10% Na-deoxycholate, 2 mL 100 mM EDTA, and 1 μg protease inhibitors), were homogenized and sonicated, and protein concentrations were determined by Bradford assay. Denaturing sample buffer (1 mL 2× glass-distilled water, 640 μL 1M Tris-HCl [pH 6.8], 420 μL 30% glycerol, 250 μL β-mercaptoethanol, 200 μL 0.05% bromophenol blue, and 0.125 g recrystallized SDS) was added to 30 to 50 μg of protein and loaded onto 4% to 12% precast Tris-glycine gels for separation, followed by transfer to nitrocellulose membranes. Membranes were blocked for 2 hours with 5% nonfat dry milk after by application of specific primary antibodies to β1-adrenergic receptor (diluted 1:50, Santa Cruz Biotechnology, Santa Cruz, CA), β2-adrenergic receptor (diluted 1:50, Santa Cruz Biotechnology), and iNOS (diluted 1:500; Chemicon, Temecula, CA) incubated overnight at 4°C. All blots were washed three times with blocking buffer and then incubated at room temperature with the appropriate secondary antibodies combined with horseradish peroxidase at a 1:5000 dilution. After secondary antibodies, blots were washed and placed into chemiluminescence reagent (GE Healthcare, Little Chalfont, UK) for detection (ImageStation 2000r; Eastman Kodak, Rochester, NY). Mean densitometry of immunoreactive bands was assessed with software accompanying the image station, and results were expressed in densitometric units and compared to the nontreated groups.

Immunocytochemistry for β-adrenergic receptors was also performed to verify the presence of β-1- and β-2-adrenergic receptors on cultured rat Müller cells. Müller cells (50,000) were plated onto chamber slides in either high (25 mM)- or low (5 mM)-glucose medium and allowed to attach and proliferate in the respective media for 2 days. Cells were fixed for 10 minutes in 4% paraformaldehyde, rinsed twice with 1× PBS, permeabilized for 7 minutes in 100% cold methanol, rinsed with 1× PBS twice, blocked at 25°C in normal goat serum (Vector Laboratories, Burlingame, CA) for 1 hour in a humidified chamber, and rinsed again twice with 1× PBS. Slides were incubated overnight with a 1:100 dilution of rabbit anti-β-1-adrenergic receptor or rabbit anti-β-2-adrenergic receptor (Santa Cruz Biotechnology). The following day, the slides were rinsed twice with 1× PBS and incubated for 2 to 3 hours with 1:500 dilution of anti-rabbit secondary antibody conjugated to Cy3 (Jackson ImmunoResearch Laboratories, West Grove, PA). After rinsing twice with 1× PBS, the slides were coverslipped in mounting medium (Fluoromount-G; Southern Biotechnology Associates, Inc., Birmingham, AL).

ELISA Assay

ELISA assays were performed for ICAM-1 (Biosource, Camarillo, CA), PGE2 (Pierce Biotechnology, Rockford, IL), TNFα (Fisher Scientific, Pittsburgh, PA), and IL-1B (R&D Systems, Minneapolis, MN) according to the manufacturer’s instructions, except that the exact amount of protein was loaded, rather than using a standard curve. Protein content was determined by the Bradford assay. Analyses were performed by using absorbance values obtained at the appropriate wavelength.

Statistical Analysis

Because the sample sizes are small in cell culture experiments, statistics using nonparametric tests were run. For these experiments, the nontreated control was compared with all drug-treated groups by Mann-Whitney test, with P < 0.05 considered significant. For the high-glucose versus low-glucose experiments, a Mann-Whitney test was also used, with P < 0.05 considered significant.

Results

β1 and β2-Adrenergic Receptors in Müller Cells

Before investigating whether isoproterenol alters inflammatory marker levels in rat retinal Müller cells, we first verified that retinal Müller cells express β1- and β2-adrenergic receptors. These results show that both adrenergic receptor subtypes are present on rat Müller cells using both Western blot (bands at 68 kDa) and immunofluorescence techniques and that hyperglycemia resulted in an upregulation of β1-adrenergic receptor expression (P < 0.05 vs. low glucose in Western blot analysis, Figs. 1A 1Evs. 1B 1E ).

Effect of Isoproterenol on Protein and mRNA Levels of TNF-α

With treatment of isoproterenol, steady state mRNA expression of TNF-α displayed no significant changes (Fig. 2A) . After incubation in 25 mM glucose, rMC-1 cells showed increased production of TNF-α compared with cells cultured in low-glucose medium (P < 0.05 vs. low glucose, Fig. 2B ). With the addition of 10 μM isoproterenol to the cells cultured in high glucose, a significant decrease in protein level production was seen after 1 hour of stimulation, which continued for at least 24 hours when compared with that of the samples not treated with isoproterenol (P < 0.05 vs. not treated, Fig. 2C ).

IL-1B Protein Levels in rMC-1 Cells after Isoproterenol Treatment

Steady state mRNA expression for IL-1B showed an increase at 24 hours after isoproterenol treatment (P < 0.05 vs. nontreated, Fig. 3A ). IL-1B protein levels were increased in high glucose levels compared with low glucose (P < 0.05 vs. low glucose, Fig. 3B ), whereas levels of protein production of IL-1B were decreased significantly as early as 1 hour after treatment with isoproterenol and remained low for the duration of the times investigated (P < 0.05 vs. not treated; Fig. 3C ). These results suggest that stimulation of rMC-1 cells in a hyperglycemic environment with isoproterenol can decrease production of IL-1B protein.

Effect of Isoproterenol Treatment on Gene Expression and Protein Levels of iNOS in rMC-1 Cells Cultured in High Glucose

Cells cultured in high glucose compared with low glucose (LG) alone showed increased iNOS protein levels (P < 0.05 vs. LG, Figs. 4B 4C ), whereas isoproterenol treatment of rMC-1 cells cultured in high glucose significantly decreased iNOS protein at all time points relative to nontreated cells (P < 0.05 vs. nontreated, Figs. 4D 4E ). Similarly, stimulation of rMC-1 cells with isoproterenol significantly decreased steady state mRNA levels of iNOS after 1 hour of treatment (P < 0.001, Fig. 4A ).

Effect of Isoproterenol Treatment on PGE2 Content in rMC-1 Cells

rMC-1 cells cultured in high- or low-glucose did not have altered PGE2 levels (Fig. 5A) . Stimulation with isoproterenol, however, significantly decreased PGE2 levels at 1 hour after treatment in rMC-1 cells cultured in hyperglycemia (P < 0.05 vs. NT high; Fig. 5B ).

ICAM-1 mRNA Expression after Isoproterenol Treatment

Stimulation with isoproterenol significantly increased steady state mRNA expression for ICAM-1 within 1 hour of treatment (P < 0.05, Fig. 6A ), which then returned to nontreated levels by the 6-hour time point. ICAM-1 protein content exhibited no changes due to high-glucose medium or isoproterenol treatment (Figs. 6B 6C) .

Discussion

Recent studies have suggested that inflammation may be a contributing factor to the microvascular and glial changes noted in diabetic retinopathy.⁵In addition, work in primary human retinal endothelial cells cultured in high-glucose medium indicates that hyperglycemia leads to an increase in inflammatory markers, especially iNOS.³Because Müller cells are also affected in diabetic retinopathy,⁴it is highly possible that they may increase production or secretion of inflammatory markers during hyperglycemia. The results from the present study suggest that this does occur, as increased protein production of IL-1B and TNF-α was observed in rat Müller cells cultured in high-glucose DMEM.

IL-1B is known to be upregulated in many diseases, including inflammatory bowel disease, chronic renal failure, and diabetic retinopathy.⁷ ¹³ ¹⁴Specifically, Figures 3B and 3Cshows that IL-1B protein levels were increased in cells cultured in a hyperglycemic environment but that isoproterenol treatment could reduce IL-1B levels. However, the mRNA for IL-1B is increased at 24 hours after isoproterenol treatment, suggesting that the gene expression and protein levels for IL-1B in hyperglycemia are not in agreement. Why this occurs is unclear, but the gene product may be unstable or require additional posttranslational modifications that do not occur after isoproterenol treatment. Nonetheless, these results are in agreement with previous findings that maintenance of sympathetic neurotransmission can alter Müller cell reactivity and other markers of diabetic retinopathy.³ ¹⁰Our findings agree with those of Gerhardinger et al.⁴who suggested that IL-1B protein expression is significantly increased in Müller cells after introduction into hyperglycemic conditions. Furthermore, IL-1B protein levels have also been observed in retinal capillary cells cultured under hyperglycemic conditions.⁷

One of the other inflammatory markers observed to be upregulated by hyperglycemia in cultured rat Müller cells is TNF-α. TNF-α is known to be produced in a variety of cells, including macrophages, astrocytes, microglia, and reactive retinal Müller cells.¹⁵Joussen et al.¹⁶also found that protein levels of TNF-α increase with the onset of diabetes-like conditions. In addition to the observation that TNF-α protein levels were increased in hyperglycemia, the current data also indicate that in culture, stimulation with isoproterenol can reduce protein levels of TNF-α within 1 hour, suggesting that maintenance of sympathetic neurotransmission may protect the retina against inflammation-associated changes. Although our findings focus on diabetes, previous findings in the heart lend support to our results. Smart et al.¹⁷found that TNF-α plays a role in heart disease. His findings suggest that treatment with isoproterenol can significantly reduce TNF-α levels after stimulation with lipopolysaccharide (LPS). These findings suggest that maintenance of sympathetic neurotransmission can protect both the heart and retina against inflammatory disorders.

NO has been shown to exert negative effects through different pathways in several diseases, including diabetic retinopathy.¹⁸ ¹⁹Previous investigations have shown that TNF-α and IL-1B stimulate NO production through activation of inducible nitric oxide synthase.²⁰Protein levels and gene expression for iNOS was significantly increased relative to samples treated with isoproterenol in a cultured diabetes-like environment (Fig. 4) . The results are in agreement with Du et al.¹¹who reported that iNOS is one of the major contributors to NO production in Müller cells. In previous works, it has been shown that iNOS protein levels in Müller cells in a high-glucose environment could be inhibited with high doses of aspirin and aminoguanidine,¹¹whereas the findings in the present study show that treatment of isoproterenol produces a similar response. These results further strengthen the relationship between cytokines and β-adrenergic signaling in the scope of diabetic retinopathy.

Although levels of PGE2 were not altered in high-glucose versus low-glucose medium, treatment with isoproterenol did significantly reduce PGE2 levels within 1 hour of treatment. These results may explain why it has been found that loss of sympathetic neurotransmission leads to increased PGE2 levels, whereas no changes were observed in retinal endothelial cells cultured in high glucose.³The changes observed after sympathectomy were probably occurring in Müller the cells, rather than in the endothelial cells of the retina.

Unlike the findings for TNF-α, iNOS, and IL-1B, hyperglycemia did not increase protein production of ICAM-1 in rMC-1 cells. The current results showing limited (not significant) increases in ICAM-1 production are in contrast to recent work by Shelton et al.²¹However, in the work by Shelton et al., ICAM-1 levels were determined by Western blot, whereas ours were by ELISA assay. In addition, our rMC-1 cells are grown in medium with either 5 or 25 mM glucose and 10% FBS, after starvation and before the start of experimental treatments. Whether these differences can account for the different findings is not clear; however, the possibility does exist.

Although the present study supports much of the previous work on rat and human Müller cells in culture, it adds to present knowledge by indicating that hyperglycemia leads to increased expression of β₁-adrenergic receptors, with little effect on β₂-adrenergic receptors. Because we have additional data to suggest that norepinephrine levels are significantly reduced as early as 1 week after streptozotocin (STZ) treatment (Steinle et al., unpublished observations, 2007), this loss of norepinephrine may lead to denervation supersensitivity, initially, in the retina, resulting in the increased β₁-adrenergic receptor expression on Müller cells. It is unclear why similar changes are not observed for β₂-adrenergic receptors. It also appears that β-adrenergic receptor expression is reduced in the retina in the endothelial cells and Müller cells after hyperglycemia induced by STZ (Steinle et al., unpublished observations, 2007). Therefore, maintenance of normal adrenergic receptor signaling in times of hyperglycemia may have effects on both the glial and endothelial cells of the retina.

In conclusion, the current findings indicate that β₁- and β₂-adrenergic receptors are expressed in retinal Müller cells. These findings are the first, to our knowledge, to show that β-adrenergic receptors are present in rat Müller cells. In addition, they show that stimulation of β-adrenergic receptors on rat Müller cells can reduce cytokine levels in hyperglycemia. Results also support previous reports that hyperglycemia leads to increased inflammatory marker content in Müller cells. These results add further support that Müller cells are modulated in a hyperglycemic environment and that β-adrenergic receptors on these cells may influence cytokine activities in the retina.

Supported by Career Development Award 2-2006-114 from the Juvenile Diabetes Research Foundation (JJS).

Submitted for publication February 2, 2007; revised April 11, May 23, and June 28, 2007; accepted September 7, 2007.

Disclosure: R.J. Walker, None; J.J. Steinle, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Jena J. Steinle, Hamilton Eye Institute, Department of Ophthalmology, 930 Madison Avenue, Suite 722A, Memphis, TN 38163; jjsteinle@utmem.edu.

Table 1.

View Table

List of Real-Time PCR Primers

Table 1.

List of Real-Time PCR Primers

Primers	Primer Sequence (5′ to 3′)	Accession Numbers
iNOS forward	TCCCCCACATTCTCTTTCC	D44591
iNOS reverse	GCAGCTAAATATTAGAGCAGCG	D44591
IL-1B forward	CGACAGAATCTAGTTGTCC	NM_031512
IL-1B reverse	TCATAAACACTCTCATCCACAC	NM_031512
ICAM-1 forward	CCCCACCTACATACATTCCTAC	NM_012967
ICAM-1 reverse	ACATTTTCTCCCAGGCATTC	NM_012967
TNF-a forward	CCTTATCTACTCCCAGGTTCTC	NM_012675
TNF-a reverse	TTTCTCCTGGTATGAATGGC	NM_012675
18S rRNA forward	TCAAGAACGAAAGTCGGAGGTT	X01117 K01593
18S rRNA reverse	GGACATCTAAGGGCATCACAG	X01117 K01593

Figure 1.

Confocal images of β1- and β2-adrenergic receptor expression on unstimulated Müller cells, confirming Western blot data. (A) β1-Adrenergic receptors in high glucose; (B) β1-adrenergic receptors in low glucose; (C) β2-adrenergic receptors in high glucose; (D) β2-adrenergic receptors in low glucose; (E) mean protein levels of β1-adrenergic receptors in high versus low glucose; and (F) protein levels of β2-adrenergic receptors in high versus low glucose. β1-Adrenergic receptor protein levels are increased under hyperglycemic conditions. For the Western blot images, nontreated (NT) cells were grown in either high (25 mM) or low (5 mM) glucose for 5 days, starved for 18 hours, and then collected for Western blot analysis. *P < 0.05 vs. low glucose; n = 4 for Western blot analysis; n = 3 for immunocytochemistry. Magnification, ×400; scale bar, 10 μm.

View Original Download Slide

Confocal images of β₁- and β₂-adrenergic receptor expression on unstimulated Müller cells, confirming Western blot data. (A) β1-Adrenergic receptors in high glucose; (B) β1-adrenergic receptors in low glucose; (C) β2-adrenergic receptors in high glucose; (D) β2-adrenergic receptors in low glucose; (E) mean protein levels of β1-adrenergic receptors in high versus low glucose; and (F) protein levels of β2-adrenergic receptors in high versus low glucose. β1-Adrenergic receptor protein levels are increased under hyperglycemic conditions. For the Western blot images, nontreated (NT) cells were grown in either high (25 mM) or low (5 mM) glucose for 5 days, starved for 18 hours, and then collected for Western blot analysis. *P < 0.05 vs. low glucose; n = 4 for Western blot analysis; n = 3 for immunocytochemistry. Magnification, ×400; scale bar, 10 μm.

Figure 2.

View Original Download Slide

(A) Real-time PCR analysis of TNF-α mRNA expression in rMC-1 cells cultured in high glucose after timed treatments. (B) ELISA analysis to determine the effect of TNF-α in high- and low-glucose medium. Cells were cultured in the appropriate medium for 5 days before analysis. (C) ELISA of the effect of TNF-α for timed treatments. Isoproterenol decreased protein levels of TNF-α. (*P < 0.05 vs. NT n = 4 for real-time PCR, n = 3 for ELISA assay). Nontreated samples were cultured in high glucose.

Figure 3.

View Original Download Slide

(A) Real-time PCR analysis to detect IL-1B in cells cultured in high glucose at different treatment time points. (B) ELISA analysis to detect IL-1B from high glucose and low glucose. Cells were cultured in the appropriate medium for 5 days before analysis. (C) Mean absorbance of IL-1B for timed treatments of isoproterenol. Levels of protein production of IL-1B were decreased significantly as early as 1 hour after treatment with isoproterenol (*P < 0.05 vs. NT, n = 4 for real-time PCR; n = 3 for ELISA assay). Nontreated samples were cultured in high glucose.

Figure 4.

View Original Download Slide

(A) Bar graph of real-time PCR to detect iNOS from high glucose at different treatment time points. (B) Western blot analysis to determine the effect of iNOS in high- versus low-glucose medium (C) Mean densitometry of iNOS in nontreated protein samples from high- versus low-glucose medium. (D) Blot image of the effects of isoproterenol on iNOS in Müller cells cultured in high-glucose (25 mM glucose) medium and nontreated or treated with 10 μM isoproterenol for the times shown. (E) Mean densitometry of iNOS on protein samples at each time point. Protein levels of iNOS were significantly decreased at all time points after isoproterenol treatment. (*P < 0.05, **P < 0.01 vs. NT, n = 4 for both real-time PCR and Western blot analysis.)

Figure 5.

View Original Download Slide

(A) ELISA analysis to detect PGE2 levels from high and low glucose. Cells were cultured in the appropriate medium for 5 days before analysis. (B) Mean absorbance of PGE2 for timed treatments of isoproterenol. Levels of PGE2 were decreased significantly as early as 1 hour after treatment with isoproterenol. (*P < 0.05 vs. NT high, n = 3 for ELISA assays). Nontreated samples were cultured in high glucose.

Figure 6.

View Original Download Slide

(A) Real-time PCR analysis to detect ICAM-1 from high glucose for different timed treatments. Steady state ICAM-1 mRNA expression significantly increased within 1 hour of treatment and returned to nontreated levels by 6 hours. (B) ELISA analysis of ICAM-1 from high and low glucose. The cells were cultured in the appropriate medium for 5 days before analysis. (C) Mean absorbance of ICAM-1 after timed treatments of 10 μM isoproterenol in high glucose. ICAM-1 protein level production exhibited no changes after isoproterenol treatment (n = 4 for real-time PCR; n = 3 for ELISA assay). Nontreated samples (NT) were cultured in high glucose.

FletcherEL, PhippsJA, Wilkinson-BerkaJL. Dysfunction of retinal neurons and glia during diabetes. Clin Exp Optom. 2005;88:132–145. [CrossRef] [PubMed]

American Diabetes Association. Alexandria, VA. Available at: www.diabetes.org/diabetes-statistics/complications.jsp. Accessed September 6, 2007. ;

SteinleJJ. Sympathetic neurotransmission modulates expression of inflammatory markers in the rat retina. Exp Eye Res. 2007;84:118–125. [CrossRef] [PubMed]

GerhardingerC, CostaMB, CoulombeMC, TothI, HoehnT, GrosuP. Expression of acute-phase response proteins in retinal Müller cells in diabetes. Invest Ophthalmol Vis Sci. 2005;46:349–357. [CrossRef] [PubMed]

KradyJK, BasuA, AllenCM, et al. Minocycline reduces proinflammatory cytokine expression, microglial activation, and caspase-3 activation in a rodent model of diabetic retinopathy. Diabetes. 2005;54:1559–1565. [CrossRef] [PubMed]

JoussenAM, PoulakiV, LeML, et al. A central role for inflammation in the pathogenesis of diabetic retinopathy. FASEB J. 2004;18:1450–1452. [PubMed]

KowluruRA, OdenbachS. Role of interleukin-1beta in the pathogenesis of diabetic retinopathy. Br J Ophthalmol. 2004;88:1343–1347. [CrossRef] [PubMed]

AntonettiDA, BarberAJ, BronsonSK, et al. Diabetic retinopathy: seeing beyond glucose-induced microvascular disease. Diabetes. 2006;55:2401–2411. [CrossRef] [PubMed]

BurnstockG. Changes in expression of autonomic nerves in aging and disease. J Auton Nerv Syst. 1990.S25–S34.

WileyLA, RuppGR, SteinleJJ. Sympathetic innervation regulates basement membrane thickening and pericyte number in rat retina. Invest Ophthalmol Vis Sci. 2005;46:744–748. [CrossRef] [PubMed]

DuY, SarthyVP, KernTS. Interaction between NO and COX pathways in retinal cells exposed to elevated glucose and retina of diabetic rats. Am J Physiol. 2004.735–741.

VincentJA, MohrS. Inhibition of caspase-1/interleukin-1beta signaling prevents degeneration of retinal capillaries in diabetes and galactosemia. Diabetes. 2007;56:224–230. [CrossRef] [PubMed]

BuraczynskaM, KsiazekP, KubitP, ZaluskaW. Interleukin-1 receptor antagonist gene polymorphism affects the progression of chronic renal failure. Cytokine. 2006;36:167–172. [CrossRef] [PubMed]

MaloMS, BiswasS, AbedrapoMA, YehL, ChenA, HodinRA. The pro-inflammatory cytokines, IL-1beta and TNF-α, inhibit intestinal alkaline phosphatase gene expression. DNA Cell Biol. 2006;25:684–695. [CrossRef] [PubMed]

TezelG, WaxGB. Increased production of tumor necrosis factor-a by glial cells exposed to simulated ischemia or elevated hydrostatic pressure induces apoptosis in cocultured retinal ganglion cells. J Neurosci. 2000;20:8693–8700. [PubMed]

JoussenAM, PoulakiV, MitsiadesN, et al. Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-α suppression. FASEB J. 2002;16:438–440. [PubMed]

SmartKR, Jr, WarejckaDJ, CastresanaMR, DaltonML, WebbJG, NewmanWH. Isoproterenol inhibits bacterial lipopolysaccharide-stimulated release of tumor necrosis factor-α from human heart tissue. Am Surg. 2000;66:947–951. [PubMed]

GoldsteinIM. Nitric oxide: a review of its role in retinal function and disease. Vision Res. 1995;36:2979–2994.

CleeterMW, CooperJM, Darley-UsmarVM, MoncadaS, SchapiraAH. Reversible inhibition of cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, by nitric oxide: implications for neurodegenerative diseases. FEBS Lett. 1994;345:50–54. [CrossRef] [PubMed]

MollaceV, ColasantiM, MuscoliC, et al. The effect of nitric oxide on cytokine-induced release of PGE2 by human cultured astroglial cells. Br J Pharmacol. 1998.742–746.

SheltonMD, KernTS, MieyalJJ. Glutaredoxin regulates nuclear factor kappa-B and intercellular adhesion molecule in Müller cells: model of diabetic retinopathy. J Biol Chem. 2007;282:2467–2474.

Figure 1.

View Original Download Slide