Novel Allele of Crybb2 in the Mouse and Its Expression in the Brain

Abstract

purpose. O377 was identified as a new dominant cataract mutation in mice after radiation experiments. The purpose of this study was to genetically characterize the mutation and to analyze its biological consequences.

methods. Linkage analysis of the O377 mouse mutant was performed; candidate genes including Crybb2 were sequenced. The authors analyzed eyes and brains of the mutants by histology and the expression domains of Crybb2 by in situ hybridization and immunohistochemistry. RNA was isolated from whole brains of heterozygous and homozygous O377 mutants, and differential expression arrays were performed. All studies were compared with age- and strain-matched wild-type mice.

results. The mutation was mapped to chromosome 5 and characterized as an A→T substitution at the end of intron 5 of the Crybb2 gene. It led to alternative splicing with a 57-bp insertion in the mRNA and to 19 additional amino acids in the protein. In the brain, βB2-crystallin was expressed in the cerebellum, olfactory bulb, cerebral cortex, and hippocampus. The only morphologic difference in the brain is the increased number of Purkinje cells in the cerebellum of homozygous strain-matched mutants. Differential expression analysis revealed the upregulation of calpain-3 in the brain of homozygous mutants, which was confirmed by quantitative real-time PCR.

conclusions. These results confirm the third allele of Crybb2 in the mouse that also affected exon 6 and the fourth Greek key motif. Moreover, expression analysis of Crybb2 identified for the first time distinct regions of expression in the brain, and the differential expression analysis points to the participation of Ca²⁺ in the corresponding pathologic processes.

Congenital cataracts have been shown in the past 15 years to be caused by mutations in a few genes that encode mainly proteins responsible for the structural integrity of the lens either in the cytosol (the crystallins) or on the membranes (MIP, connexins). Increasing numbers of mutations identified several alleles that do not seem to be randomly distributed (for a review, see Graw ¹ ). To identify the functionally important domains of the corresponding proteins, the characterization of even more mutations in mammals is required. 

One of the important structural proteins of the vertebrate eye lens is βB2-crystallin (gene symbols: Crybb2 in mouse, CRYBB2 in human). ² Mutations in the Crybb2/CRYBB2 gene are associated with dominant hereditary lens opacities. In humans, hereditary cataracts from seven independent families with variable phenotypes are attributed to mutations in the CRYBB2 gene; five of them have been explained by gene conversion between CRYBB2 and its pseudogene. ^{3 4 5 6 7} Santhiya et al. ⁸ have recently identified a second causative allele in the CRYBB2 gene in an Indian family, and Pauli et al. ⁹ have identified a third one in a German family. In all cases analyzed, the resultant clinical phenotype is expressed in heterozygotes, indicating a dominant mode of inheritance. There are no reports on other clinical features in cataract patients outside the lens. 

In mice, the Crybb2 gene is located on chromosome 5 within a cluster of three other Cryb genes. It consists of four Greek key motifs, which are common characters of all members of the β- and γ-crystallin superfamily. ¹⁰ Like the other Cryb genes, Crybb2 consists of six exons, the first of which is untranslated. The second exon codes for the N-terminal extension, ¹¹ and each of the subsequent four exons codes for one Greek key motif. The corresponding human gene (CRYBB2) is mapped to chromosome 22q11.2; a pseudogene (CRYBψB2) of CRYBB2 is also present on chromosome 22q11.2. ¹²  

In mice, the spontaneous Philly cataract ¹³ and the ENU-induced Aey2 mutant ¹⁴ are Crybb2 mutant alleles, leading to progressive cataracts. We identified a new mouse mutation (O377) leading to cataract, which is presented here as the third allele of the murine Crybb2 gene. In mice, Crybb2 is also expressed in brain and testes ¹⁵ ; the Philly mice were demonstrated recently to be subfertile. ¹⁶ Moreover, Crybb2 was shown to be involved in the elongation of axons during the regeneration of retinal ganglion cells. ¹⁷ However, the function of CRYBB2 in neuronal tissue is unknown. Here we report for the first time on the particular expression areas of βB2-crystallin in the brains of mice and on differentially expressed genes. The results point to a particular participation of Ca²⁺ in the corresponding pathologic processes. 

Materials and Methods

Mice

Mice were kept at the GSF-National Research Center for Environment and Health in Neuherberg, in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the regulations of the German Law on Animal Protection. The original mutant, expressing progressive cataract, was recovered in the offspring of male mice exposed to 3 Gy x-ray irradiation. The presumed mutation was genetically confirmed and crossed to strain C3H/El; all further characterizations described here have been performed on this genetic background. For linkage analysis, congenic C3H/El-O377 mice were outcrossed to wild-type strain C57BL/6EI. The mutation was mapped relative to microsatellite markers according to methods described previously. ^{18 19} Segregation data were analyzed with Map Manager (version 2.6.5), and the gene order was determined by minimizing the number of multiple crossovers. 

PCR, Sequencing, and Protein Modeling

RNA was isolated from lenses, retinas, and brains and transcribed to cDNA according to standard procedures; genomic DNA was isolated from liver or tail tips. Using the primers Crybb2-L3 (5′-ATGGCCTCAGACCACCAGACAC-3′) and Crybb2-R1 (5′-GGCACGAGCCACACTTTATTCTTC-3′), PCR products of 667 bp (wt) or 724 bp (O377 mutants) were observed. Sequencing was performed commercially (SequiServe, Vaterstetten, Germany) after isolation of the DNA from the gel (Nucleospin Extract; Macherey-Nagel, Düren, Germany). 

The mRNA sequence was translated using the ExPASy Proteomics server available at http://www.expasy.org/. The PDB file used to model the proteins was generated from The SwissModel First Approach Mode (http://swissmodel.expasy.org//SWISS-MODEL.html). The protein has been modeled using the MDL Chime software (http://www.mdl.com). 

For quantitative real-time PCR (qRT-PCR), 3 μg brain RNA from C3HeB/FeJ (C3H) and O377 mice (n = 4 mice/strain) was reverse transcribed into first-strand cDNA (Ready-to-Go T-Primed First-Strand Kit; Amersham Biosciences, Freiburg, Germany) in a 33-μL reaction volume, in accordance with the manufacturer’s instruction. cDNA (1 μL) was used in a subsequent PCR reaction using 11.5 μL mix (Absolute qPCR SYBR Green ROX; ABgene, Hamburg, Germany), 1.0 μL each primer, and 10.5 μL RNase-free water. Primers (Table 1)for Capn3, Tmsb4x, CR536618, 1700065I16Rik, Sgne1, Stmn1, and Actb were ordered and purchased from metabion International AG (Martinsried, Germany), and analysis was performed with a sequence detection system (ABI PRISM 7000; Applied Biosystems, Foster City, CA) under the following conditions: 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. For relative quantitation of expression of each gene between the C3H strain and its O377 mutant line, the comparative C_T method (ΔΔC_T) was used. ΔC_T = C_T (gene of interest) − C_T (Actb). This value was calculated for each sample, where C_T = cycle number threshold. The comparative ΔΔC_T calculation involved finding the difference between the ΔC_T of each sample and the mean ΔC_T for the C3H strain. These values were then transformed to absolute values using the formula: Comparative expression level = 2^−ΔΔC_T . 

Morphologic and Histologic Analysis

Slit lamp ophthalmologic examination was conducted according to standard procedures (http://www.eumorphia.org/EMPReSS). Enucleation of the eyes and histology were performed essentially as described previously. ²⁰  

Brains from adult mice (transcardially perfused with 4% paraformaldehyde in PBS) were paraffin embedded and cut on a microtome in 8-μm-thick sections for immunohistochemistry. The βB2-crystallin antibody was kindly provided by Joseph Horwitz (Los Angeles, CA); the ABC kit for polyclonal antibodies was from Vectastain (Vector Laboratories, Burlingame, CA). 

Stereological counting of the Purkinje cells of cerebellar lobe V was performed using Cresyl violet-stained, free-floating sagittal cryosections (50 μm thick; HM 560; Microm, Walldorf, Germany) mounted on clean grease-free slides. Nine animals (3 weeks old) each of wild-type and homozygous mutant were analyzed (Stereoinvestigator; Microbrightfield Inc., Williston, VT). 

Protein Analysis

Water-soluble proteins were extracted from lens and brain tissue using protein extraction buffer (50 mM Tris/HCl [pH 7.8], 3 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride). Concentration of protein was estimated using a protein assay kit (Protein Quantitation RC DC; Bio-Rad, Munich, Germany). Samples were stored at −80°C. 

For Western blotting, 16% SDS PAGE gels were used to separate the proteins. Amounts ranging from 5 to 10 μg protein were sufficient for a reproducible band from the lens, whereas 70 to 80 μg protein was necessary to detect a visible band of βB2-crystallin from brain. Before running the gel, the protein samples were denatured by incubation with Laemmli buffer at 100°C for 5 minutes. The gel was run using 1% SDS running buffer at 200 mA for 1 to 1.5 hours. One part of the gel was stained by Coomassie blue, destained, and dried in a gel drier for reference, and the other part was used for blotting. Blotting was performed with the use of a blotter and pure nitrocellulose membrane (0.2 m; Trans-Blot Transfer Medium; Bio-Rad). After blotting, the membrane was blocked by 5% fat-free milk powder (Roth, Karlsruhe, Germany) solution. It was incubated overnight in the dark at 4°C on a shaker in anti-βB2-crystallin antibody (developed in rabbit; kindly provided by Joseph Horwitz, University of California at Los Angeles) dissolved in the blocking solution (1:1000). The secondary antibody used was anti-rabbit IgG (whole molecule) peroxidase conjugate, developed in goat (Sigma, Taufkirchen, Germany). DAB staining was performed to develop the band (3,3′-diaminobenzidine [Sigma]; 5 mL 5× buffer; 20 mL H₂O; 100 μL CoCl₂ [10 μg/μL]; 10 μL H₂O₂). 

In Situ Hybridization

In situ hybridization on paraffin sections of eyes from 1-day-old animals was performed according to standard procedures. Briefly, RNA probes were chosen from the N-terminal extension of Crybb2 and from the entire Capn3 gene and were labeled with digoxigenin-rUTP (Roche, Mannheim, Germany) during synthesis from linearized cDNA templates according to the manufacturer’s instructions. The clones were linearized with EcoRI and XbaI and were synthesized with Sp6 and T7 RNA polymerase for the antisense and sense probes, respectively. Sections were analyzed under a microscope (Axioplan; Zeiss, Göttingen, Germany) and documented with a high-resolution charge-coupled device color camera (AxioCam; Zeiss). Pictures were adjusted for brightness, contrast, and color balance in Adobe Photoshop 6.0 and 7.0. 

Expression Profiling

Whole brains of wild-type C3HeB/FeJ mice and heterozygous and homozygous O377 mutants were collected at 4 weeks of age. Total RNA was isolated from dissected brains according to the manufacturer’s protocol (RNeasy Midi kits; Qiagen, Hilden, Germany). Per DNA chip, 20 μg total RNA was used for reverse transcription and indirectly labeled with Cy3 or Cy5 fluorescent dye according to The Institute for Genomic Research (TIGR) protocol, as previously described. ²¹  

Gene-specific DNA probes were PCR amplified from the Lion Bioscience (Heidelberg, Germany) 20K mouse arrayTAG clone set, as recently described. ²² Four independent biological samples were analyzed in 15 chip hybridizations; each sample was analyzed in three or four experimental replicates, including dye swap experiments. Slides were scanned (Axon 4000A; Molecular Devices, Sunnyvale, CA), and images were processed with Axon software (GenePix Pro 3.0; Molecular Devices). All unflagged spots detectable by the software were used for analysis with a local background algorithm. All data were normalized by adjusting the median of log ratios of Cy5 to Cy3 intensities to 0. For data analysis and generation of heat plots, Pattern Analysis of Microarrays software was used, as recently described ^{21 23 24} ; it is also freely available from our Web site (http://www.helmholtz-muenchen.de/en/ieg/group-gene-regulation/technical-aspects/natural-variability/index.html). Gene expression data were normalized independently for each DNA chip. 

Results

Eye Morphology, Mapping, and Molecular Analysis of the O377 Mutant

A novel mouse mutant line (O377) with progressive, dominant cataracts and small lenses was established on the C3H genetic background after paternal x-ray irradiation (Fig. 1) . Histologic analysis of the eyes at postnatal day (P) 1 indicated no differences between the wild-type lenses and the lenses of the mutants (Figs. 2A 2B 2C 2D 2E 2F) . At day 4 (Figs. 2G 2H 2I 2J 2K 2L) , in heterozygous mutants the fiber cell nuclei were not fully degraded and remained present even in the center of the lens. The homozygous mutants exhibited more severe effects on differentiation: the central fiber cells were detached from the anterior epithelium, and the cells in the equatorial zone were misshaped and disoriented. At P21 (Figs. 2M 2N 2O 2P 2Q 2R) , cataract also progressed in the heterozygotes to vacuoles in the center and to a stop of elongation in the equatorial region. The homozygous mutants had smaller lenses with larger vacuoles; the situation at the lens equator, however, was similar to that in the heterozygotes. 

Linkage analysis with 112 backcross animals (60 O377/+ and 52 +/+) mapped the mutation to the distal part of chromosome 5: D5Mit239 – [2/112] – O377 – [0/112] – D5Mit24 – [11/112] – D5Mit138 (in brackets,: the frequency of recombinants between adjacent markers). Because there was no recombination between the mutation O377 and the marker D5Mit24, it mapped the O377 locus close to position 60 cM. This region contains the Crybb1, Crybb2, Crybb3, and Cryba4 gene cluster. Sequencing of the cDNAs of these four genes from homozygous O377 mutants revealed a 57-bp insertion (Fig. 3A)at the beginning of exon 6 in Crybb2. The remaining three Cryb genes were not affected. Analysis of genomic DNA indicated the mutation to be attributed to an A→T bp substitution at the end of intron 5; it changes the conserved AG splice acceptor site to an inefficient TG. Therefore, the mutation leads to the use of an alternative splice site 57 bp upstream within intron 5. These 57 base pairs code for 19 additional amino acids at the beginning of the fourth Greek key motif of the βB2-crystallin. The predicted structure of βB2-crystallin ^O377 (Fig. 3B)shows an additional loop near the carboxyl terminus. 

Expression Domains of Crybb2 in the Brain

Based on earlier reports, ¹⁵ we assayed for and observed Crybb2 and Crybb2 ^O377 transcripts in the entire mouse brain; however, the expression level was much lower (approximately 1:20) than in the lens. Time-course studies suggested that the Crybb2 transcript is best detectable in the brain during postnatal development through adolescence and diminishes thereafter (Fig. 4) . Immunohistochemistry (Fig. 5)demonstrated Crybb2 predominantly in neurons of the olfactory bulb (mitral cell layer and glomerular layer), hippocampus (pyramidal cells of the CAI, CAII, CAIII regions and granule cells of the dentate gyrus), cerebral cortex (pyramidal cells throughout all layers), and cerebellum (Purkinje cells and stellate cells of the molecular layers). 

No major morphologic or histologic changes were observed in the brains of 3-week-old mutant animals except for the difference in frequency and size of Purkinje cells in the cerebellum (at vermis) of the homozygous mutants. Using unbiased stereological methods, we counted 12,581 (± 454 SEM) Purkinje cells in cerebellar lobe V of wild-type mice but 13,993 (± 183 SEM) Purkinje cells in the homozygous mutants, representing a significant increase of 11% (P = 0.011) and indicating subtle morphologic consequences in the brain attributed to the Crybb2 mutation compared with strain-matched controls. The decrease in size of Purkinje cells was qualitatively observed repeatedly but was not quantified (Fig. 6) . 

Expression Profiling

To assess global changes in gene expression levels in the brains of O377 mutants, we performed expression profiling experiments using genomewide DNA microarrays. Only homozygous mutants revealed different RNA expression profiles compared with wild-type mice. We detected six genes upregulated and seven genes downregulated in whole brains of homozygous mutants in all 15 DNA-chip hybridizations. Mean absolute expression ratios of significantly regulated genes ranged from approximately 1.3- to 3.5-fold (Fig. 7A) . These 13 regulated genes contained less than one false-positive gene (P > 0.05). The complete expression data set is available from the GEO (Gene Expression Omnibus) database (GSE3761 for the series of experiments and GLP 1216 for the description of the platform). 

The upregulated genes coding for calpain-3 (Capn3) and CR536618 showed the strongest difference (3.5- and 2.4-fold) for all probes with reproducible expression in all chip hybridizations. Among the downregulated genes, Sgne1 (coding for a secretory granule neuroendocrine protein) and Stmn1 (coding for stathmin) showed the strongest effects. These differences in the level of gene expression were detected despite the fact that whole brains were used for the assessment of differential expression profiles. The changes of the expression of the top three upregulated or downregulated genes were confirmed by qRT-PCR (Fig. 7B ; Capn, 3.2×; Tmsb4x, 1.8×; CR536618, 2.1×; 1700056I16Rik, 0.5×; Sgne1, 0.6×; Stmn1, 0.8×). 

Expression Pattern of Crybb2 and Capn3 in the Eyes of 0377 Mutants

The expression pattern of Crybb2 in the lens is shown in Figure 8 . It indicates that both the mRNA and the protein are present in the lens cortex and that it is more strongly expressed in the mutants. In contrast, Crybb2 transcripts are also present in the wild-type eye in the anterior part of the retina in the inner limiting membrane. This retinal expression was not observed in the mutants. 

Because calpains are frequently discussed in cataractogenesis (see Ref. ²⁵ ), we also tested Capn3 expression in the developing lens (Fig. 9)because we have seen its overexpression in the O377 mutant brain. It turned out that Capn3 expression in the lens epithelium was stronger in heterozygous and homozygous mutants than in wild-type mice. Moreover, the staining of Capn3 was restricted to the cell nuclei and therefore was different from the staining of crystallin mRNA, as demonstrated for Crybb2 itself (Fig. 8) . Further studies will be performed to analyze the different expression patterns of Capn3 in the brains of wild-type and 0377 mutant mice. 

Discussion

O377 is a new mouse mutant with hereditary, progressive, dominant cataract caused by a mutation in the Crybb2 gene. The A→T base pair substitution in the acceptor splice site of intron 5 of the Crybb2 gene leads to the activation of an alternative splice site resulting in an mRNA with an additional 57 bp. Because of the inclusion of 19 additional amino acids at the beginning of the fourth Greek key motif, the βB2-crystallin ^O377 protein has a molecular weight 1.9 kDa higher than that in the wild type. The O377 mutants were detected after paternal irradiation (3 Gy x-ray); however, such A→T substitutions are uncommon because of ionizing irradiation. ²⁶ Therefore, this particular mutation might be of spontaneous origin coincidentally detected in x-ray irradiation experiments. 

In addition to O377, two other mouse mutations in Crybb2—the Philly mouse ¹³ and the Aey2 mutant—have been reported. ¹⁴ Both have been described as having progressive cataracts. As do the O377 mutants, the Philly lenses develop normally until the first postnatal week, when particles appear in the anterior cortex that extend, by the 10th day, to the anterior subcapsular area. Loss of the normal lens denucleation process (as in the O377 mutants) and swelling of the lens fibers follow; the characteristic bow configuration of the nuclei is replaced by a fan-shaped configuration. ²⁷ In contrast, in the Aey2 mutants, the cataractous changes were observed at eye opening as a diffuse opacity in the cortex and abnormally branched anterior suture. This type of opacity remained stationary until 8 to 11 weeks of age, after which total opacity developed. ¹⁴  

In addition to the phenotypical similarities, all three mutations affect the start of the fourth Greek key motif. In the lens, the misfolding of the mutated βB2-crystallin might lead to altered aggregation properties, as previously reported for the Philly mouse, ²⁸ and for three different mouse γ-crystallin mutants, including deposition of amyloidlike inclusions. ²⁹ This interpretation is particularly supported by histologic analysis demonstrating, in the early stage of cataractogenesis, the stop of lens fiber cell denucleation followed by a stop of the elongation process in the equatorial zone and the formation of vacuoles in the center of the lens. 

In humans, mutations in CRYBB2 lead to a remarkable phenotypic heterogeneity. The mutation Q155X is caused by a gene conversion mechanism ⁵ and affects five geographically and genetically disparate pedigrees. ^{3 4 5 6 7} Two more alleles (W151C, D128V) in human are yet to be described. ^{8 9} In addition to the D128V mutation, all other human CRYBB2 cataract mutations affect the beginning of the fourth Greek key motif. 

In this study, we were able to demonstrate for the first time the expression of Crybb2 in distinct areas of the brain, particularly in the olfactory bulb, the cortex, the hippocampus, and the cerebellum. Surprisingly, the only morphologic changes in the brain were found in the cerebellum of homozygous mutants, in which the number of Purkinje cells was slightly enhanced. Given that the expression profiling data revealed differences only in the homozygous mutants, it may be suggested that a brain-related phenotype will be recessive. This is in line with the observation that no additional clinical observations were reported in patients with heterozygous CRYBB2 cataract. 

However, because Crybb2 is expressed in the brain, a function must be attributed. A first hint might come from the observation in a cDNA microarray study, which identified CRYBB2 to be downregulated in the nucleus accumbens of cocaine abusers. ³⁰ It should be noted that only 49 of the 44,928 transcripts under investigation were differentially expressed in the majority of cocaine abusers. Another more recent study ¹⁷ demonstrated the presence of Crybb2 in primary hippocampal neurons and neurites. The authors discuss a putative function of Crybb2 in the context of axonogenesis and growth cone movement. Therefore, a more detailed neuroanatomic investigation will be necessary to prove this hypothesis, at least in the hippocampus. Nevertheless, the slightly reduced size of Purkinje cells in the cerebellum of the O377 mutants might also be interpreted on the basis of this hypothesis. 

In our own microarray study on whole brains, we observed an increased expression of calpain-3 in the homozygous mutants. Calpains are Ca²⁺-dependent intracellular cystein proteases that are suggested to be involved in the proteolysis of crystallins. Because of the known participation of calpains in cataractogenesis (for a review, see Biswas et al. ²⁵ ), we checked the expression pattern of Capn3 first in eyes of embryonic mutant mice. The increased expression of Capn3 in the lens epithelial cells of the mutant embryos suggests increased proteolytic activity and participation of Ca²⁺ in cataractogenesis. Because βB2-crystallin is discussed as a Ca²⁺-binding protein, ³¹ proposing the Greek key crystallin fold as a Ca²⁺-binding motif, ³² it is tempting to speculate that Ca²⁺ signaling and Capn3 overexpression, with subsequent enhanced calpain activity, are major components contributing to cataract formation in Crybb2 mutants. Moreover, to achieve an understanding of the function of Crybb2 in the brain, these findings might be relevant to address the first research questions in this new field. 

In summary, our study demonstrated the third independent cataract-causing allele in the mouse Crybb2 gene. Expression analysis of Crybb2 pointed for the first time to its expression in particular regions of the brain and to an increased number of smaller Purkinje cells in the cerebellum of the homozygous mutants. In situ hybridization also revealed increased Capn3 expression in epithelial cells of cataractous lenses, suggesting a participation of Ca²⁺ in the pathologic processes initiated by the mutation in the Crybb2 gene and by the impaired function of the βB2-crystallin. 

 Submitted for publication June 27, 2007; revised November 8, 2007; accepted February 14, 2008.

 Disclosure: K. Ganguly, None; J. Favor, None; A. Neuhäuser-Klaus, None; R. Sandulache, None; O. Puk, None; J. Beckers, None; M. Horsch, None; S. Schädler, None; D. Vogt Weisenhorn, None; W. Wurst, None; J. Graw, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Primer for Quantitative Real-Time PCR

Primer	Sequence (5′→3′)	Product Length (bp)	tm (°C)
Capn3_For1	CACCCAAGTGGCATCTATTCAGC	200	65.0
Capn3_Rev1	TCCGGAGGTCTCTTCCAGACGA		66.0
Tmsb4x_For1	GCTCCTTCCAGCAACCATGTCT	182	64.0
Tmsb4x_rev1	TGTACAGTGCATATTGGCGGCG		64.0
AK018879_For1	AGGAGGAAACTGAGGTCGCCCA	198	66.0
AK018879_Rev1	CCCACTCTGGCACAATGCACAC		66.0
AK087812_For2	GAGACGGCTGACCTTGGATTCTGA	187	67.0
AK087812_Rev2	TCGCAGTGACGTTCTATCTCCACG		67.0
Sgne1_For1	TCAAGGCTGGTCTCTGCTATGC	208	64.0
Sgne1_Rev1	GTGGCCCAACAAGATTCATGGC		64.0
Stmn1_For1	CGCAAGTCTCATGAGGCGGAA	204	63.0
Stmn1_Rev1	CTTGTCCTTCTCTCGCAAGCGC		66.0
β-Actin_For	TCCATCATGAAGTGTGACGT	154	61.7
β-Actin_Rev	GAGCAATGATCTTGATCTTCAT		59.7

Figure 1.

 

Morphology of the O377 mutant eyes. Gross appearance of the mutant lens at the age of 6 months (left, wild-type; middle, heterozygote; right, homozygous mutant). Isolated lenses of heterozygous and homozygous mutant eyes show severe forms of opacity, as evident from the white patches in dark-field photographs. The eye lenses in heterozygous and homozygous mice are reduced in size.

Figure 2.

 

Development of cataract formation. Eyes of wild-type mice (wt), heterozygous (O377 ^±) and homozygous (O377 ^{− / −}) mutants were analyzed at P1, P4, and P21. Transverse sections of the eyes were stained by methylene blue and basic fuchsin. Insets: magnifications of regions shown in the lower panel. The main ocular tissues are indicated as Co (cornea), Le (lens), and Re (retina). Scale bars: (A–L) 0.2 mm; (M–R) 50 μm.

Figure 3.

 

Molecular analysis of the O377 mutant. (A) Part of the genomic sequence of Crybb2 representing the 3′ end of intron 5 and the beginning of exon 6 (red) is given for the C3H/El wild-type strain and the O377 mutant. The A→T transition is shown in blue; the splice junctions are underlined. The additional 57 bp present in the Crybb2 ^O377 -mRNA are given in yellow, together with the predicted additional 19 aa. (B) Predictive modeling of the βB2-crystallin ^O377 protein. The βB2-crystallin ^O377 protein is misfolded (indicated by the red arrow) near the carboxyl terminus because of the additional 19 amino acids in this region. wt, wild type.

Figure 4.

 

Expression of Crybb2 in the brain. (A) Both the wild-type (C3H), and the mutant transcripts (O377) of the Crybb2 gene were detected in the lens and brain after RT-PCR. The identities of the products were confirmed by sequencing. The Crybb2 ^O377 transcript is 57 bp longer than the wild-type Crybb2 transcript. The lane marked by “–” represents the negative control. (B) The level of expression of βB2-crystallin protein in brain is compared with the lens. Five micrograms of lens protein yields a prominent band of βB2-crystallin (23 kDa), whereas 80 μg brain protein is required to get a visible band. The mutant βB2-crystallin is approximately 1.9 kDa larger than the wild-type form. (C) Crybb2 transcripts can be detected in the brain at early postnatal development and diminishes thereafter; it cannot be detected at the age of 8 months in mutant or in strain-matched, wild-type mice. m, months.

Figure 5.

 

Identification of βB2-crystallin expression in particular areas of the brain. The histology (Cresyl violet staining) of sagittal sections of the olfactory bulb (A), the cerebellum (D), the cortex (G), and the hippocampus (J) of a 3-week-old wild-type brain are given. Immunohistochemistry revealed the expression domains of βB2-crystallin protein to be in the glomerulus and mitral cell layers of the olfactory bulb (B, C). Purkinje cells and stellate cells (molecular layer) of the cerebellum (E, F). Pyramidal cells of the cortex (H, I) and in the CAI, CAII, CAIII (CA = Cornu ammonis), and dentate gyrus of the hippocampus (K, L) in wild-type (B, E, H, K) and homozygous (C, F, I, L) mutant mice. Red arrows: βB2-crystallin–positive regions. Scale bars: (A, G) 50 μm; (B–D, H, I) 20 μm; (E, F) 10 μm; (J–L) 0.1 mm.

Figure 6.

 

Stereological study of the Purkinje cells. (A) The index photograph shows the cerebellar lobes of a 3-week-old animal; cerebellar lobe V is marked by a red arrow. (B, C) The same region of cerebellar lobe V of homozygous mutant animals and strain-matched wild-type mice is shown. The size of the Purkinje cells appeared to be slightly smaller in the homozygous mutants (qualitative observation only). (D) Results of the stereological counting are given; the number of Purkinje cells is 11% higher in cerebellar lobe V of the homozygous mutants than in the strain-matched wild-type (wt) mice (9 animals of each genotype were used; 3 weeks of age). *P = 0.011; t-test, two-tailed. Statistically significant difference from the wild type (wt). Scale bars: (A) 0.2 mm; (B, C) 20 μm.

Figure 7.

 

RNA expression profiling. (A) Fifteen dual-color DNA chip hybridizations (columns in the heat plot) from four homozygous mutant brains (mice 1–4) against a pool of four strain-matched wild-type brains were performed. Expression ratios are depicted in red (up-regulated in mutant) and green (downregulated in mutant) in the heat plot. The colored scale bar on the left shows the related color code for the ratio. All genes shown in this figure have reproducible upregulation or downregulation in all 15 chip experiments. Genes are ranked according the lowest absolute ratio in 15 experiments (Min abs. on the nonlogarithmic scale). In addition, the absolute mean ratio of expression in 15 experiments is given (Mean abs. on the nonlogarithmic scale). The Lion ID is the unique probe identifier from the Bioscience Array Taq Clone set. Probe sequences were blasted over the mouse genome using MouseBLAST on the MGI interface to determine the current official mouse gene symbol. (B) Transcript levels of calpain 3 (Capn3), thymosin-β4-X chromosome (Tmsb4X), CR536618 (AK018879), 1700065I16Rik (AK087812), secretory granule neuroendocrine protein 1 (Sgne1), and stathmin 1 (Stmn1) in the brains of 4-week-old C3Heb/FeB (C3H) and O377 mice are given. qRT-PCR was performed, and the comparative C_T method (ΔΔC_T) was used [where ΔC_T = C_T (gene) − C_T (Actb)] for quantitation of the data. The ΔΔC_T calculation involved finding the difference between each sample’s ΔC_T and the mean ΔC_T for the C3H strain. Data are presented as relative C3H expression (mean ± SEM, n = 4 mice/strain). Significant differences in expression levels were found between the C3H and 0377 strains for all transcripts (t-test, P ≤ 0.05), reflecting the microarray results.

Figure 8.

 

Expression of Crybb2 in the eye. The expression of Crybb2 is compared between wild-type eyes (left) and 0377^−/− eyes (right) from 1-day-old animals. Top row: comparison of the βB2-crystallin proteins, indicating that in the mutant lens more protein is present in the cortical regions. Middle row: an even stronger difference is observed by in situ hybridization for mRNA using digoxigenin-labeled Crybb2 probes. Bottom row: however, magnification of the lens bow region indicates that in the mutants, no Crybb2 mRNA can be observed in the internal limiting membrane of the retina in the region near the iris (red arrows). Scale bars: (top) 0.2 mm; (middle) 100 μm; (bottom) 20 μm. C, cornea; L, lens; R, retina.

Figure 9.

 

In situ hybridization of Capn3 in embryonic lenses of the 0377 mutant mice. The expression of Capn3 is compared between wild-type eyes (left) and heterozygous or homozygous 0377 eyes (middle or right) from embryonic mice (embryonic day [E] 15.5 and E17.5). In the lens, Capn3 is expressed in the epithelial cells and the differentiating fiber cells; the Capn3 transcripts, however, remain restricted to the cell nuclei, as indicated by the dotlike distribution. It is also expressed in the inner and anterior parts of the retina. In all tissues, Capn3 is more strongly expressed in the mutants. Scale bars: 100 μm. C, cornea; L, lens; R, retina.

The authors thank Joseph Horwitz (University of California at Los Angeles) for kindly providing the primary antibody against βB2-crystallin; Utz Linzner (Helmholtz Center Munich, Institute of Experimental Genetics, Munich, Germany) for providing the oligonucleotides; and Erika Bürkle (Helmholtz Center Munich, Institute of Developmental Genetics), Monika Stadler (Helmholtz Center Munich, Institute of Developmental Genetics), and Martina Schreiber (Helmholtz Center Munich, Institute of Inhalation Biology, Neuherberg, Germany) for excellent technical assistance.