Analysis of α₂-adrenergic Receptors and Effect of Brimonidine on Matrix Metalloproteinases and Their Inhibitors in Human Ciliary Body

Abstract

purpose. To ascertain the expression pattern of α₂-adrenergic receptors in the ciliary body (CB) and determine the effect of brimonidine on matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) in ciliary body smooth muscle (CBSM) cells.

methods. Qualitative RT-PCR was performed to detect the mRNA of the α₂-adrenergic receptor subtypes α₂A, α₂B, and α₂C in CB and CBSM cultures. Immunohistochemistry and immunoblot analysis were performed to further investigate α₂A receptor expression in CB tissue and CBSM cells. CBSM cells from 15 different human donors received control or brimonidine tartrate (45 nM) for 1, 3, or 7 days. Changes in pro-MMP-1, -2, -3, -9, and -24 and TIMP-1, -2, -3, and -4 levels were evaluated by Western blot, with GAPDH as the endogenous control. Zymography was used to assess the activity of MMP-1, -2, -3, and -9.

results. The mRNA of α₂A, α₂B, and α₂C were detected in CB tissue and CBSM cells. Immunohistochemistry localized α₂A receptors within the CB stroma. Immunoblot analysis demonstrated production by CBSM cells. Brimonidine increased pro-MMP-9 an average of 116% ± 34% (P = 0.0360); enzymatic activity of MMP-9 was unchanged. TIMP-4 decreased an average of 25% ± 8% (P = 0.0329) in conditioned medium, but increased 70% ± 13% (P = 0.0057) in cell lysates.

conclusions. The presence of α₂A, α₂B, and α₂C in CB tissue and CBSM cells indicates the possibility that brimonidine affects uveoscleral outflow. However, the changes in MMP-9 and TIMP-4 without significant changes in MMP-9 activity suggest that a role of the MMP/TIMP system in outflow is unlikely.

Elevated intraocular pressure (IOP) is a causative risk factor for the incidence and prevalence of glaucoma. ¹ The exact molecular events that regulate IOP remain elusive, but elevated IOP results from abnormal aqueous outflow. ² Some antiglaucoma medications lower IOP by enhancing aqueous drainage. By studying the underlying mechanism by which these medications act, a fundamental control mechanism for IOP regulation may be elucidated. 

Brimonidine tartrate (Alphagan; Allergan, Irvine, CA) was introduced in the United States in 1996. As a monotherapy, brimonidine lowers IOP approximately as effectively as timolol when used three times daily. ³  

Some fluorophotometry studies have suggested that brimonidine enhances uveoscleral outflow, ^{4 5 6} but not all studies have found a change in uveoscleral drainage with brimonidine. ⁷ Apraclonidine, a relatively nonselective α₂-adrenergic agonist, worsens outflow facility, perhaps due to its worse receptor selectivity for α₂. ⁸ Brimonidine decreases aqueous secretion by stimulation of the three α₂-adrenergic receptor subtypes: α₂A, α₂B, and α₂C (Gluchowski C, et al. IOVS 1994;35:ARVO Abstract 669). ^{9 10 11 12 13} Activation of α₂-adrenoceptors decreases cyclic adenosine monophosphate (cAMP) levels in the nonpigmented ciliary body (CB) epithelium, resulting in lower aqueous production. ^{4 8 14 15} Receptor ligand binding and immunohistochemical studies consistently show strong signal/binding (i.e., high density) within the CB epithelium, the anatomic location of aqueous production. ^{16 17} Two research groups sought to identify the expression and distribution of α₂-adrenergic receptors and agreed that α₂B and α₂C are in CB stroma. ^{17 18} However, they disagreed on the presence of α₂A. 

Within the CB stroma portion of the uveoscleral tract, outflow resistance can be modulated by both ciliary smooth muscle cell tone ^{19 20 21 22 23} and enhanced turnover of extracellular matrix (ECM) by matrix metalloproteinases (MMPs). ^{24 25 26 27 28 29 30 31} Eleven MMPs are expressed in the CB smooth muscle (CBSM) cells. ³¹ Latanoprost, a prostaglandin F_2α analogue, enhances uveoscleral outflow by shifting the MMP:TIMP ratio toward increased ECM turnover in the CB; ^{27 28 29 31 32} the ECM changes are observable morphologically. ^{24 25} In CB, latanoprost has been shown to induce or increase the expression of MMP-1, -2, -3, -9 and -17. ^{26 29 31} In trabecular meshwork, latanoprost increases the mRNA of MMP-1, -3, -17, and -24. ³³ Our purpose was to ascertain the expression of α₂-adrenergic receptor A in CB stroma and to determine the effect of brimonidine on selected MMPs and tissue inhibitors of metalloproteinases (TIMPs) on CBSM cells. 

Methods

Tissue and Cell Culture

The expression of the three α₂-adrenergic receptors was determined by isolating the anterior segment and CB tissue in corneoscleral buttons from three donor eyes (three donors: two 61 years and one 56 years of age; Lions Eye Bank of Delaware Valley, Philadelphia, PA). For the study of MMPs and TIMPs, CBs were dissected from human donor corneoscleral buttons obtained from the Massachusetts Eye and Ear Infirmary within 6 hours of corneal transplant surgery. CBSM cell cultures were generated from CBs isolated from 15 separate donor eyes, ages 23 to 65 years (National Disease Research Interchange, Philadelphia, PA, and Lions Eye Bank of Delaware Valley). All procedures were performed in accordance with the Declaration of Helsinki. 

From whole eyes, the anterior segment of the globe was incised and isolated approximately 5 mm posterior to the limbus. After careful removal of the lens and iris, the CB was pulled from its attachment to the scleral spur. In general, significant portions of longitudinal ciliary muscle remains attached to the scleral spur; the longitudinal fibers are the area of filtration through the uveoscleral tract. This tissue is then sharply dissected from the sclera spur and isolated for culture. 

CBSM cells were cultured according to previously published protocols. ^{31 32} The cell identity confirmatory immunohistochemistry, performed by labeling with anti-desmin and anti-smooth muscle actin antibodies as described by Weinreb et al., ³² revealed that >99% of cells in culture were CBSM cells. In addition, our cells had a typical morphologic appearance, with individual cells having a spindle shape; once confluent, the cells grew in bundles mimicking the pattern in muscles. The cultures were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen-Gibco, Grand Island, NY) containing 20% fetal bovine serum, 1% l-glutamine (2 mM), and gentamicin (0.1 mg/mL) at 37°C in a 10% CO₂ atmosphere. All the cells used were from passage-4 and -5 cultures. 

Once grown to confluence, the cultures were maintained for 1 week. The cells were incubated in serum-free medium for 24 hours and exposed to vehicle control (0.02% distilled water) or to 45 or 450 nM of brimonidine tartrate (Allergan, Irvine, CA), for 24 hours; 45 nM approximates the peak aqueous concentration after topical administration of brimonidine. ^{34 35 36} Cell lines from four donors were further treated for 7 days; the medium was changed and collected daily with supplementation of brimonidine 45 nM, and immunoblot analysis and zymography were performed in four cell lines after 3 and 7 days of treatment. 

Reverse Transcription–Polymerase Chain Reaction

RT-PCR was performed using total RNA isolated from CB tissue and CBSM cells (SuperScript One-Step RT-PCR with Platinum Taq System; Invitrogen) in accordance with the manufacturer’s protocol, which includes a DNAase step. RT-PCR was initially performed with oligonucleotide primers specific to the mRNA of the α₂-adrenergic receptor subtypes (Table 1) . Two tubes were run in parallel with the second tube containing only Taq polymerase to ensure that the source of the RT-PCR product was mRNA. For each reaction, 100 ng of template RNA was used (200 μM dNTP, 1.2 mM Mg, 0.2 μM of each primer). Amplification was performed with a thermocycler (model 2700, Thermocycler; Applied Biosystems, Inc. [ABI], Foster City, CA). The parameters were as follows: cDNA synthesis 50°C for 25 minutes; denaturation at 94°C for 2 minutes; and amplification for 40 cycles of 94°C for 15 seconds, annealing for 20 seconds, and extension at 72°C for 45 seconds. A final extension of 72°C for 10 minutes was run after the 40 cycles. The mRNA concentration in the CB tissue was low, and so reamplification was performed (PCR reagent system; Invitrogen). 

Ten percent of the RT-PCR product was used as DNA template for the PCR reaction. PCR conditions were as follows: incubation at 94°C for 2 minutes, followed by amplification at 94°C for 30 seconds, annealing for 30 seconds, and extension at 72°C for 30 seconds for 35 cycles. A final extension was run at 72°C for 7 minutes. Reamplification was not necessary for cultures of CBSM cells. 

Gel electrophoresis was performed on the PCR products using a 2% agarose gel (E-gel; Invitrogen). ôX174 RF DNA/HaeIII ladder (Invitrogen) was run concurrently to verify band size. The RT-PCR product was then purified (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) in accordance with the manufacturer’s protocol. The DNA was sequenced at the core facility at Jefferson Medical College. Results from the sequencing were analyzed by using the standard nucleotide-nucleotide (blastn) algorithm contained in the BLAST software package (www.ncbi.nlm.nih.gov/blast/ provided in the public domain by NCBI, Bethesda, MD). 

Immunofluorescent Staining

The 4- and 6-μm 10% formalin-fixed, paraffin-embedded anterior segment sections were deparaffinized in xylene, rinsed with phosphate-buffered saline with 0.05% Tween 20 (PBS-T), and incubated with 10% normal goat serum and then with polyclonal antibody against the α₂A-adrenergic receptor (dilution 1:100; Genex Bioscience, Hayward, CA) and a monoclonal antibody against α-smooth muscle actin (dilution 1:100; Sigma-Aldrich, St. Louis, MO). Binding of the primary antibodies was localized with Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG (dilution 1:100; Invitrogen-Molecular Probes, Eugene, OR). Alexa Fluor 488 phalloidin (dilution 1:400; Invitrogen-Molecular Probes) was incubated with the secondary antibodies. Images were then analyzed with a fluorescence microscope (BX51; Olympus, Lake Success, NY). 

Because the cross-reactivity within the nuclei has been observed by other groups using anti-α-smooth muscle actin antibodies, ³⁷ we performed additional staining with anti-F-actin, anti-α₂A-adrenergic receptor antibodies, and nuclear stain. 

Western Blot Analysis

Western blot analysis was used to determine protein levels. Equal amounts of protein from whole-cell lysates or concentrated (Amicon Ultra-4, 10K; Millipore, Milford, MA) conditioned medium were mixed with 2× reducing buffer (125 mM of Tris-HCl [pH 6.8], 4% SDS, 20% glycerol, 0.01% bromophenol blue, and 5 mg/mL DTT) at a 1:10 ratio and were boiled for 3 minutes. The samples were electrophoresed in 11% SDS-polyacrylamide gel at 130 V in tank buffer (250 mM Tris, 192 mM glycine, and 0.1% SDS), in a mini electrophoresis system (XCell SureLock Mini-Cell; Invitrogen). The separated proteins were blotted onto a nitrocellulose membrane with 0.45-μm pore size (Invitrogen) in blotting buffer (250 mM Tris, 192 mM glycine, and 10% methanol). The membrane was incubated in blocking buffer (Rockland, Gilbertsville, PA) and 1× TBS (20 mM Tris-HCl [pH 7.6], and 137 mM NaCl) at 1:1 ratio at room temperature. The membrane was then incubated in primary antibody (Table 2)buffered with blocking buffer and 1× TBS/T (1× TBS with 0.1% Tween-20) at a 1:1 ratio overnight at 4°C. The following day after washing in TBS/T for 10 minutes, the membranes were incubated with infrared dye (IRDye 800)-conjugated affinity purified anti-Mouse or anti-Rabbit IgG (Rockland, Gilbertsville, PA) diluted 1:10,000 for 1 hour. The membranes were washed with 1× TBS/T and scanned with an infrared imaging system (Odyssey; Li-Cor, Lincoln, NE). The bands were quantified with densitometric software (Olympus; Li-Cor). 

Zymographic Analysis

Zymography is used to analyze the ability of MMP-2 and -9 to degrade gelatin and MMP-1 and -3 to degrade casein. Zymography techniques for MMPs other than MMP-1, -2, -3, and -9 have not been described in studies of ocular tissue. Gelatin (0.1%) or β-casein (0.1%) was mixed into liquid acrylamide when casting polyacrylamide gels. Concentrated conditioned medium was mixed with 2× Tris-glycine-SDS zymography sample buffer (125 mM Tris-HCl [pH 6.8], 4% SDS, 20% glycerol, 0.01% bromophenol blue) at a 1:10 ratio and was loaded into 10% SDS-polyacrylamide gels. The samples were electrophoresed at 130 V in tank buffer. The gels were washed at room temperature with 2.5% Triton X-100 (renaturing buffer), then transferred to development buffer (50 mM Tris-HCl [pH 7.5], 0.2 M NaCl, 5 mM CaCl₂, and 0.05% NaN₃) overnight at 37°C. The resultant gels were stained with 0.1% Coomassie brilliant blue G-250 (Bio-Rad, Hercules, CA) solution for at least 3 hours, then destained with fixing/destaining solution until clear bands were visible and contrasted well with the blue background of the nondegraded substrate. The gels were scanned and analyzed for relative densities with the infrared imaging system (Odyssey; Li-Cor). All the MMPs were identified based on their molecular weights resolved by zymography and were confirmed by purified MMP-1, -2, -3, and -9 (Chemicon, Temecula, CA) as positive controls. 

Statistical Analysis

Results are presented as the mean ± SEM and statistical significance (P < 0.05) was evaluated by (paired) Student’s t-test or repeated-measures one-way ANOVA. 

Results

α₂-Adrenergic Receptor Expression

The mRNA transcripts were identified for α₂A, α₂B, and α₂C in CB tissue and CBSM cells (Fig. 1A) . Because of the disagreement regarding the expression of α₂A, we also sought the distribution of the protein; Western blot analysis demonstrated bands from both CB tissue and CBSM cells (Fig. 1B) . Immunofluorescence staining revealed strong reactivity of the epithelium, but a very low signal pattern within the stroma (Fig. 2 3) . Dual staining showed that α₂A has a very low level of overlap with α-smooth muscle actin and F-actin, respectively. Although the CBSM cells transcribe α₂A in culture, the protein is present in very low levels in vivo. 

Effect on MMP and TIMP Levels

MMPs -1, -2, -3, and -9 are secreted proteins and were identified in conditioned medium (Fig. 4A) . We were not able to detect them in the cell lysates. Conversely, MMP-24 (MT5-MMP) was membrane bound and found in the cell lysates (Fig. 4A)but not in the conditioned medium. The major unglycosylated form of pro-MMP-1 was present approximately 70% more than the glycosylated form (P = 0.0305). However, there was approximately 90% more glycosylated pro-MMP-3 than the major unglycosylated form (P = 0.0181). Little is known about the physiological function of glycosylation of these MMPs. 

In response to the peak pharmacologic dose of brimonidine, 45 nM, pro-MMP-9 increased 116% ± 34% (P = 0.026; Table 3 , Fig. 5A ). An increase in pro-MMP-9 by 42% ± 12% (P = 0.0394) was also seen at 3 days. The levels of pro-MMP-1, -2, -3, and -24 did not change at 1 or 3 days (P > 0.05). At 7 days, there was a decrease of approximately 50% of all MMPs, TIMPs, and GAPDH compared with baseline values, although there were no observed morphologic changes in the cultured cells. The enzymatic activity of MMP-1, -2, and -9 did not change at 1 or 3 days. Intermediate MMP-1 and active MMP-2 and -9 were identified with positive controls on zymography (Fig. 6) . MMP-3 was not identified on zymography. No changes in the level or activity of the examined MMPs were seen at 24 hours with 450 nM brimonidine. 

TIMP-1, -2, -3, and -4 were found at 28, 21, ³² 27, and 29 kDa, respectively (Fig. 4B) . All TIMPs were found in both conditioned medium and cell lysates. However, in cell lysates, the basal levels of TIMP-1, -2, and -3 are consistently close to the lowest limit of detection; brimonidine did not significantly change the basal protein levels. 

In conditioned medium, TIMP-4 decreased an average of 25% ± 8% (P = 0.0329) at 45 nM of brimonidine, with a further dose-dependent decrease of 38% ± 13% (P = 0.0417) in response to 450 nM brimonidine (Fig. 5B) . In cell lysates, TIMP-4 increased an average of 70% ± 13% (P = 0.0057) at 45 nM brimonidine (Fig. 5C) . No other significant changes were found. 

Discussion

Our results confirm the transcription of α₂B and α₂C in CB tissue and CBSM cells found by other groups. ^{17 18} We have demonstrated that α₂A is also present at very low levels similarly reported by Bylund and Chacko. ¹⁸ CBSM cell cultures had greater amounts of α₂A. The causes of this difference may be due to greater amounts of α₂A relative to the total protein content since the sole source of protein from CBSM cell cultures are the cells and underlying matrix. Since all three receptors are expressed by CBSM cells, it is plausible that brimonidine has an effect on uveoscleral outflow. Evidence from transgenic null mice with deletion of the individual α₂-adrenergic receptors indicates that, separately, these receptors are not involved in diurnal IOP variation. ⁴⁸  

In most tissues, the MMP:TIMP ratio determines the rate of ECM turnover. ^{49 50 51} MMPs are zinc-dependent endopetidases, and with the exception of the membrane bound subfamily, are secreted as inactive/zymogen (i.e., pro-) forms. Once activated, MMPs, as a group, can degrade all components of the surrounding ECM as well as activate proteins involved in cell signaling. ⁵² Membrane-bound MMPs can degrade ECM components immediately surrounding the plasma membrane, but also have regulatory roles such as activation of pro-MMPs. ^{53 54 55 56 57 58 59 60}  

Brimonidine increased the levels of pro-MMP-9. However, the activity of MMP-9 was not altered in 72 hours of treatment. We found that induction of MMP-9 is one of the significant changes in response to latanoprost. However, the increase of pro-MMP-9 without an increase in activity seems unlikely to cause increased ECM turnover. Latanoprost induces numerous changes in MMP transcription in CBSM cells. Brimonidine decreased TIMP-4 in the conditioned medium, but increased TIMP-4 accumulation in CBSM cell lysates. From this finding, we can extrapolate that the increase in pro-MMP-9, without increased activity, and disparate effects on TIMP-4 would have a small impact on uveoscleral outflow. 

In humans, brimonidine’s reported effect on uveoscleral outflow is not immediate and is seen at approximately 1 week. ^{4 6} The time course in vivo cannot be duplicated in cell culture; cell culture is a useful model system to study cellular and enzymatic action. However, we did carry cell cultures to 7 days, at which point, there was a generalized reduction of protein since the amount of GAPDH decreased dramatically despite equal protein loading. Based on the results, the period for CBSM cell cultures in a serum-free state to be used in the study of these molecular mechanisms should be no more than 72 hours. If a delayed effect on MMPs occurred, it is likely that we would have observed it. 

We were unable to identify active MMP-3 in zymography. One group described latanoprost increasing MMP-3 activity in the culture medium of complete human corneoscleral explant by casein zymographs; however, the MMP-3 could have been secreted by any of the anterior segment tissues. ²⁸ Others were able to detect MMP-3 only after enhancement by TNFα, IL-1, and 12-tetradecanoylphorbol-13-acetate (TPA)-enhanced MMP-3 expression in human trabecular meshwork in casein zymography, without which the baseline level was at the lowest limit of detection. ^{43 61 62 63 64} Weinreb et al. ²⁶ described a 50-kDa band in a casein zymograph as an intermediate or partially activated form of MMP-3 in control samples of human CB. Fully activated MMP-3 has a molecular mass of 41 to 45 kDa. ^{38 65} To confirm our assay, pure MMP-3 protein was run in casein zymography and revealed two bands at approximately 57 and 45 kDa, corresponding to pro- and intermediate or active MMP-3 (data not shown). Although we were able to identify pro-MMP-3, brimonidine did not appear to activate MMP-3. 

TIMPs are secreted proteins that are kinetic inhibitors of MMPs, but can also be involved in the activation of the zymogen form. ⁵² All four known human TIMPs are present in CB. ³¹ The presence of TIMP-4 protein in both conditioned medium and cell lysates suggests its importance in human CBSM cells. In rat vasculature, the combination of upregulation of MMP-2, and -9 accompanied by a decrease in TIMP-4 led to increased collagen turnover in vessel walls. ⁶⁶ Pro-MMP-2 is activated in TIMP-4-deficient mice, as it is in wild-type, indicating a pure inhibitory role for TIMP-4. ⁶⁷  

All the α₂-adrenergic receptors are expressed by the CBSM cells. Stimulation of α₂-adrenergic (e.g., brimonidine) and inhibition of α-1-adrenergic receptors (e.g., bunazosin) have been associated with increased uveoscleral flow. ^{4 6 68} Bunazosin does not have an appreciable effect on CBSM MMPs. ⁶⁹ Similarly, brimonidine’s effect on uveoscleral outflow does not appear to be mediated by altering the MMP/TIMP system. Further study of other ECM degrading enzymes or muscular tone may be valuable in elucidating the mechanism of increased uveoscleral outflow. 

 Supported by Grants EY13997 (DJR) EY14104 (MEEI Vision-Core Grant), Allergan, and unrestricted funds from Research to Prevent Blindness (New York, NY).

 Submitted for publication May 20, 2008; revised October 31, 2008, and February 6, 2009; accepted June 25, 2009.

 Disclosure: Y.H. Ooi, None; D.-J. Oh, None; D.J. Rhee, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Oligonucleotide Primer Sequences Used for RT-PCR

Subtype	Primer Sequences	Expected Band Size (bp)
α2A	F: CTCTTCCTGGTGTCTCTGGC	232
	R: GGTTGTACTCGATGGCCTGT
α2B	F: CCTGGCCTCCAGCATCGGAT	612
	R: ATGACCACAGCCAGCACGAA
α2C	F: GTGGTGATCGCCGTGCTGAC	573
	R: CGTTTTCGGTAGTCGGGGAC

 F, forward; R, reverse

Table 2.

 

Primary Antibodies and Dilutions Used for Western Blot Analysis

Antibodies	Manufacturer	Dilution	Identified Band (kDa)
α2A (P)	Genex Bioscience	1:5,000	49
MMP-1 (M)	R&D Systems*	1:1,000	52, 57
MMP-2 (M)	R&D Systems	1:1,000	72
MMP-3 (P)	Chemicon	1:1,000	57, 59
MMP-9 (P)	Chemicon	1:1,000	92
MMP-24 (P)	Chemicon	1:1,000	64
TIMP-1 (P)	Chemicon	1:20K	28
TIMP-2 (P)	Chemicon	1:2,000	21
TIMP-3 (P)	Calbiochem	1:200	27
TIMP-4 (P)	Chemicon	1:7,000	29
GAPDH (P)	R&D Systems	1:20–40K	36

 (M), monoclonal anti-human antibody; (P), rabbit polyclonal anti-human antibodies.

*  Minneapolis, MN.

Figure 1.

 

The mRNA transcripts of α₂A, α₂B, and α₂C in human CB tissue and CBSM cells and Western blot analysis of protein extracted from CBSM cells and CB tissue for α₂A. (A) Results of RT-PCR for mRNA of α₂-adrenergic receptor subtypes, α₂A, α₂B, and α₂C from CBSM cells and CB tissue isolated from a 56-year-old donor, showing single bands corresponding to expected sizes of 232, 612, and 573 bp, respectively. The ôX174 RF DNA/HaeIII ladder was used. Lanes correspond to blank (*), negative control (PCR only: lanes 1, 3, 6, 8, 9, and 11) and RT-PCR of CBSM cells for α₂A (lane 2), α₂B (lane 5), and α₂C (lane 10), as well as of CB tissue (lanes 4, 7, and 12). (B) Western blot of protein extracted from CBSM cells and CB tissue for α₂A at ∼64 kDa. Lanes correspond to blank (*), 10 μg of protein from CB tissue (lane 1) and CBSM cells (lane 3) and 50 μg of protein from CBSM cells (lane 2) and CB tissue (lane 4) incubated with both primary and secondary antibodies. α₂A protein from CB tissue was detected at a much lower level than from CBSM cells.

Figure 2.

 

Immunofluorescent staining of ciliary processes obtained from an 81-year-old donor eye with antibodies against α₂A (A) and α-smooth muscle actin (B). There was strong staining within the epithelium with a diffuse signal pattern within the stroma. The pattern of staining within the CB stroma shows some overlap with smooth muscle cells, rather than being isolated to blood vessels (C). A negative control with a 2° antibody only demonstrated no stain (D). Scale bar, 40 μm.

Figure 3.

 

Immunofluorescent staining of ciliary processes obtained from a 61-year-old donor eye with antibodies against α₂A (D) and F-actin (E). α₂A shows strong staining within the epithelium with a pattern of bands within the stroma. F-actin shows an even staining pattern with a pattern of actin filaments within the stroma. The staining pattern of α₂A within the CB stroma shows a very low level of overlap with F actin filaments (F) and strong overlap with the ciliary epithelium. (A, rectangle) The approximately site shown in (C–F). A negative control with a 2° antibody demonstrated no stain (B). Scale bar: (A) 200 μm; (B–F) 20 μm.

Figure 4.

 

Representative immunoblots of culture medium or cell lysates from human CBSM cells for MMPs and TIMPs. (A) Interstitial collagenase (MMP-1) was present at molecular masses of 52 ^{38 39 40} and 57 kDa, corresponding to unglycosylated and glycosylated forms of pro-MMP-1. Gelatinase A (MMP-2) was identified at 72 kDa ⁴¹ corresponding to the pro forms of MMP-2. Stromelysin-1 (MMP-3) was present at 57 ³⁸ and 59 kDa, ^{42 43} corresponding to unglycosylated and glycosylated forms of pro-MMP-3, respectively. MT5-MMP (MMP-24) was identified at 64 kDa ⁴⁴ corresponding to pro-MMP-24. (B) TIMPs-1, -2, and -3 yielded single bands at molecular masses of 28, 21, and 27 kDa, respectively, from conditioned medium. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.

Table 3.

 

Changes in MMP and TIMP Expression in Response to 24-Hour Incubation with 45 and 450 nM Brimonidine

Protein	45 nM of Brimonidine (% of Control)	450 nM of Brimonidine (% of Control)
Pro-MMP-1	1 ± 21	10 ± 28
Pro-MMP-2	8 ± 8	23 ± 10
Pro-MMP-3	15 ± 24	25 ± 26
Pro-MMP-9	116 ± 34*	25 ± 9
MMP-24 (lysates)	−13 ± 5	6 ± 13
Intermediate MMP-1	6 ± 4	7 ± 4
Active MMP-2	−3 ± 1	−4 ± 2
Active MMP-9	−1 ± 5	−2 ± 5
TIMP-1	23 ± 28	9 ± 23
TIMP-2	−3 ± 7	19 ± 19
TIMP-3	21 ± 32	15 ± 25
TIMP-4	−25 ± 8*	−38 ± 13*
TIMP-4 (lysates)	70 ± 13*	39 ± 26

 Data are expressed as the mean ± SEM.

*   P < 0.05 vs. control.

Figure 5.

 

Effect of brimonidine on MMP-9 and TIMP-4 expression levels in CBSM cells. (A) Representative immunoblot for MMP-9 expression level from a 45 year old donor. Gelatinase B (MMP-9) was identified at 92 kDa. ⁴² Densitometric analysis of five independent donors revealed that the pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (116% ± 34%) in pro-MMP-9. (B) Representative immunoblot for TIMP-4 expression level from a 40 year old donor. TIMP-4 yielded a 29-kDa single band. A statistically significant decrease (25% ± 8%) in TIMP-4 in response to 45 nM of brimonidine and a further dose-dependent decrease (38% ± 13%) at 450 nM of brimonidine from five separate donors. (C) Representative immunoblot for TIMP-4 expression level in the cell lysates from a 44-year-old donor. Densitometric analysis showed that pharmacologic dose (45 nM) of brimonidine produced a statistically significant increase (70% ± 13%) in TIMP-4. Data are the mean ± SEM of normalized densitometry measurements (n = 5). *Significant at P < 0.05 vs. control. C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.

Figure 6.

 

Representative zymograms of MMPs from the conditioned culture medium of human CBSM cells. (A) Two bands were observed in the casein zymographs corresponding to the latent (52 kDa) and intermediate (48 kDa) forms of MMP-1. ⁴⁵ Intermediate MMP-1 is 200% more active than the pro-MMP-1 (P < 0.01). (B) Four major bands were observed in the gelatin zymographs corresponding to the latent (72 kDa) and active (66 kDa) forms of MMP-2 ^{46 47} and the latent (92 kDa) and active (88 kDa) forms of MMP-9 (C). C represents control sample; 1× and 10× represent samples incubated with 45 and 450 nM of brimonidine tartrate, respectively, for 24 hours.