Effects of Pirfenidone on Proliferation, Migration, and Collagen Contraction of Human Tenon’s Fibroblasts In Vitro

Abstract

purpose. To investigate the effect of pirfenidone, a novel antifibrotic agent, on proliferation, migration, and collagen contraction of human Tenon’s fibroblasts (HTFs).

methods. After treatment of HTFs with pirfenidone, cell proliferation was measured by MTT assay. Cell migration was investigated by scratch assay. Contractility was evaluated in fibroblast-populated collagen gels. Cell viability was determined by trypan blue exclusion assay. The expression of TGF-β1, -β2, and -β3 was estimated with RT-PCR, Western blot, and immunofluorescence analyses.

results. Pirfenidone induced significant dose-dependent inhibition of HTF proliferation and migration and collagen contraction. After treatment with different concentrations of pirfenidone (0.15, 0.3, and 1 mg/mL) for 24 and 72 hours, cell viability was not different in the treatment and control groups. After 24 hours of treatment with pirfenidone, HTFs showed dose-dependent decreases in mRNA and protein levels of TGF-β1, -β2, and -β3.

conclusions. These findings indicate that pirfenidone inhibits proliferation, migration, and collagen contraction of HTFs at nontoxic concentrations. A decrease in autocrine TGF-β signaling may have a role in the effects of pirfenidone.

Glaucoma filtration surgery (e.g., trabeculectomy) is an efficient and widely used option for patients with glaucoma who have inadequate intraocular pressure (IOP) control by medication. ¹ This procedure creates an artificial fistula between the anterior chamber and subconjunctival spaces, dispelling aqueous humor into the vasculature. ¹ Successful maintenance of this pathway can decrease IOP and thus reduce the risk of glaucomatous damage. Unfortunately, scarring at the surgical site, which is the natural process of wound healing, can easily predispose the patient to surgical failure. ^{2 3} In response to this challenge, numerous attempts have been made to halt such scarring; notable are the use of 5-fluorouracil (5-FU) and mitomycin-C (MMC). Although administration of these agents could inhibit surgical scarring and increase the rate of surgical success, ¹ the complications and toxicity are far more severe than expected. Patients who underwent trabeculectomy accompanied by 5-FU or MMC could experience complications such as bleb leakage, hypotonous maculopathy, and infective endophthalmitis. ^{4 5 6 7 8 9} In addition, effects of 5-FU and MMC are highly dependent on the operator’s experience and skill, despite advances in delivery systems and technical manipulations. ¹⁰ These findings highlight the need for novel agents that can efficiently increase the surgical success rate with less toxicity and fewer complications than are associated with 5-FU and MMC. 

Pirfenidone (5-methyl-1-phenyl-2-[1H]-pyridone) is a novel agent that has shown its antifibrotic potential in animal models and clinical trials. It exerts its downregulating effects on a series of cytokines, including transforming growth factor-(TGF)-β1, ¹¹ connective tissue growth factor (CTGF), ¹² platelet-derived growth factors (PDGF), ¹³ and tumor necrosis factor (TNF)-α. ¹⁴ It has also been suggested that pirfenidone scavenges reactive oxygen species (ROS) and accordingly mediates tissue repair. ¹⁵ The antifibrotic activity and safety of this agent has been established in tissue such as lung, ^{16 17} liver, ¹⁸ and kidney. ¹² In human retinal pigment epithelial (RPE) cells, pirfenidone significantly halts TGF-β1-induced fibronectin synthesis. ¹⁹  

In light of these findings, we hypothesized that pirfenidone could suppress conjunctival scarring and therefore provide a potential therapy to mediate wound healing in glaucoma surgery. We first investigated the effects of pirfenidone on proliferation, migration, and collagen contraction of human Tenon’s fibroblasts (HTFs), key players in wound healing after glaucoma filtration surgery. ²⁰ Considering that TGF-βs are pivotal stimulators of ocular scarring, ²⁰ we examined the roles of pirfenidone on the TGF-β1, -β2, and -β3 isoforms in HTFs. In our experiments, pirfenidone prohibited proliferation, migration, and collagen contraction of HTFs. It was shown to inhibit mRNA and protein expression of these TGF-β isoforms in a dose-dependent manner. 

Materials and Methods

Cell Culture

All human tissues were procured and managed in accordance with the tenets of the Declaration of Helsinki and with approval from the institutional review board of Sun Yat-sen University in Guangzhou. Samples of human Tenon’s capsule were obtained from the Eye Bank of Zhongshan Ophthalmic Center in Guangzhou, China. Primary HTFs were harvested as an expansion culture of the human Tenon’s explants and were propagated in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen-Gibco, Karlsruhe, Germany) supplemented with 10% heat-inactivated newborn calf serum (NCS; Invitrogen-Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (Biochrom, Berlin, Germany). The cells were maintained at 37°C in 5% CO₂ in a humidified atmosphere, and those between the third and sixth passages were used for all experiments. 

MTT Assay

HTFs were seeded in 96-well plates (10⁴ cells/well) for 24 hours in DMEM/10% NCS. They were then made quiescent by culturing in medium without serum for 24 hours. These quiescent cells were then washed and immersed in DMEM with 10% of fetal calf serum (FCS) supplemented with 0, 0.01, 0.1, 0.2, 0.3, 0.5, or 1 mg/mL pirfenidone for 0, 12, 24, 48, or 72 hours. After incubation with 180 μL DMEM and 20 μL of 5 mg/mL 3-[4, 5-dimethylthiazol-2-yl] -2, 5-diphenyl tetrazolium bromide (MTT) for 4 hours at 37°C, the MTT solution was discarded. The formazan precipitates were dissolved in 180 μL DMSO (Amresco, Solon, OH) by agitating the dishes for 10 minutes at 200 rpm on an orbital shaker. The absorbance at 490 nm in each well was read with a microplate reader (Bio-Rad, Munich, Germany). We further examined the effects of pirfenidone by refining the concentrations at 0.15, 0.2, 0.25, and 0.3 mg/mL using the MTT assay. 

Flow Cytometry

HTFs were seeded on collagen-coated culture dishes and incubated with 0, 0.15, 0.2, 0.25, or 0.3 mg/mL pirfenidone for 24 hours. The cells were trypsinized, collected, and fixed with 70% ethanol for 4 hours on ice. After fixation, the cells were treated with 50 μg/mL RNase (Wako Pure Chemicals, Osaka, Japan) at 37°C for 30 minutes. Nuclei were stained by incubation in 50 μg/mL propidium iodide (PI; Wako) at 4°C for 30 minutes. They were analyzed by flow cytometry (FACS Aria; BD Biosciences, Franklin Lakes, NJ) and the cycle distribution was analyzed (Modifit; BD Biosciences). 

Cell Migration Assay

The migration of cells was measured in a scratch-wound assay in which the cells migrate from a confluent area to an area that has been mechanically denuded of cells. Initially, the HTFs were grown to a confluent monolayer and then serum deprived for 24 hours. After the medium was discarded, a scratch wound was inflicted in a straight line across the cells with a p20 pipette tip. The plates were then rinsed with PBS to remove the suspended cells and incubated with DMEM supplemented with 0, 0.15, or 0.3 mg/mL pirfenidone. Wound closure was monitored and photographed after 24 hours under a light microscope and analyzed (Photoshop 7.0; Adobe, San Jose, CA). The shortest distances between the edges of the HTFs migrating from both sides were measured. 

Fibroblast-Mediated Collagen Contraction Assay

Cultures of activated fibroblasts were prepared by growing cells to near confluence with 10% newborn calf serum, and cultures of nonactivated fibroblasts were prepared by growing cells to near confluence in serum-free medium for 60 hours to ensure residual serum depletion. One milliliter free-floating collagen type-1 (Sigma-Aldrich, St. Louis, MO) lattices were prepared according to a method described elsewhere. ²¹ Three-dimensional (3-D) models were used. Aliquots (250 μL) of a collagen/cell suspension mixture (500,000 cells/mL) were pipetted into single 24-well plates and allowed to polymerize. The gels were gently released from the walls of the well to allow contraction. Each lattice received treatment with 500 μL/well of different concentrations (0, 0.15, or 0.3 mg/mL) of pirfenidone. These lattices were incubated up to 7 days at 37°C in 5% humidified CO₂ in air. Pirfenidone was replaced every 3 days. Each experiment was repeated three times. Fibroblast-populated collage lattice (FPCL) area measurements were made with a digitizer (1212 board; Kurta, Phoenix, AZ), in conjunction with the calibration grid, directly from the photographs into an IBM-compatible computer. The areas from these digitized images were then calculated (Sigmascan software; Jandel Scientific, Corte Madera, CA). The mean of triplicate lattices was used for statistical analysis. 

Cell Viability Assay

Cell viability was evaluated by the trypan blue exclusion method. HTFs were treated with pirfenidone at the concentrations of 0, 0.15, 0.3, or 1 mg/mL. Cell viability was measured at 24 and 72 hours. Stained (dead) and unstained (viable) cells were counted with a hematocytometer. The percentage of cell viability was calculated according to the following formula: % cell viability = (viable cell count/total cell count) × 100. 

Reverse Transcription-Polymerase Chain Reaction

HTFs were treated with pirfenidone at the concentrations of 0, 0.15, or 0.3 mg/mL for 24 hours, and then total RNA was isolated from cultured cells by acid guanidium thiocyanate-phenol-chloroform extraction. A commercial system (ThermoScript RT; Fermentas, Burlington, ON, Canada) was used for the RT reactions. Each sample contained approximately 4 μg RNA. Diluted cDNA (2 μg) was used in each 25-μL PCR reaction volume. A housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. The PCR primers for TGF-β1, -β2, and -β3 were designed from published human gene sequences (Table 1) . PCR amplification was performed in a DNA thermal cycler (GeneAmp 2400; Perkin Elmer). PCR amplification was performed with an initial denaturing step at 94°C for 2 minutes, followed by cycles of denaturation (94°C, 30 seconds), annealing (63°C and 40 cycles for TGF-β1, 56°C and 35 cycles for TGF-β2, 55°C and 35 cycles for TGF-β3, 30s), extension (72°C, 30 seconds), and then a further extension (72°C, 5 minutes). Quantifications of signal intensity were confirmed using a specific computer program (IBAS2.5 Auto Image analysis; Kontron, Eching, Germany). The fidelity of RT-PCR fragments was subsequently verified by comparing the size of the amplified products with the expected cDNA bands and by sequencing the PCR products. 

Western Blot Assay

HTFs were treated with 0, 0.15, or 0.3 mg/mL pirfenidone for 24 hours. The cells were lysed in mammalian protein extraction reagent (M-PER; Pierce Biotechnology, Rockford, IL). Final protein concentrations were determined with the BCA protein assay kit (Shenergy Biocolor, Shanghai, China) according to the manufacturer’s specifications. Prepared samples were heated to 100°C for 5 minutes; for each sample the same amount of total protein was added to a well of a 10% acrylamide gel and resolved by SDS-PAGE. The separate proteins were transferred to a nitrocellulose membrane (Hybond-ECL; Amersham Biosciences, Freiburg, Germany). Nonspecific binding was blocked by incubation with 5% nonfat milk for 2 hours before overnight incubation with 1:500 anti-TGF-βs (Cell Signaling, Beverly, MA) at 4°C. After it was washed, the membrane was incubated with 1:2000 dilution of horseradish peroxidase–conjugated secondary antisera (Dako, Hamburg, Germany) in PBS-Tween. Blots were developed by chemiluminescence, to produce a signal that was captured on x-ray film (Eastman Kodak, Rochester, NY) according to the manufacturer’s instructions. Membranes or chemiluminescent films were then scanned for densitometric analysis (NIH image software; developed by Wayne Rasband, National Institutes of Health, Bethesda, MD; available at http://rsb.info.nih.gov/ij/index.html). 

Immunocytochemistry

HTFs were treated with 0, 0.15, or 0.3 mg/mL pirfenidone on coverslips for 24 hours. They were fixed with 4% paraformaldehyde for 20 minutes followed by several rinses in PBS. Nonspecific binding sites were blocked for 2 hours with normal goat serum (Sigma-Aldrich) diluted in 0.1% Triton-X-100-PBS. The cells were then incubated overnight at 4°C with primary antibodies at 1:300. Secondary antibodies conjugated with SABC-Cy3 and Hoechst were used to stain the cells, which were subsequently scanned with a confocal microscope. 

Statistical Analysis

All results are expressed as the mean ± SD. One-way analysis of variance (ANOVA), the test of homogeneity of variances, and a post hoc test (Bonferroni test) were used to determine significant differences between the pirfenidone-treated groups and the control groups. P < 0.05 was considered statistically significant. 

Results

Effects of Pirfenidone on Cell Proliferation

As shown in Figure 1 , pirfenidone demonstrated its antiproliferative effects on HTFs in the presence of serum. When compared with the 10% FCS group, cell proliferation was attenuated in the 0.2 mg/mL group after 24 hours (P < 0.001). The reduction in proliferation was more apparent in the 0.3-, 0.5-, and 1-mg/mL groups at 24, 48, and 72 hours (P < 0.001). We repeated the experiments by refining the concentration at 0, 0.15, 0.2, 0.25, and 0.3 mg/mL in three independent experiments. The effects of pirfenidone were found to start at a concentration of 0.15 mg/mL at 24 hours and reached a plateau at a concentration of 0.3 mg/mL. We thus decided that pirfenidone at doses of 0.15 and 0.3 mg/mL with 24 hours of observation was the optimum protocol for all experiments. 

These results are in agreement with the flow cytometric results (Fig. 2) . With pirfenidone treatment, the proportion of cells increased in the G₁ phase, but decreased in the S phase. This inhibition started at the concentration of 0.15 mg/mL, with 68.0% ± 4% of cells being arrested at the G₁ phase. When the concentration rose to 0.3 mg/mL, 94.5% ± 1.0% of the cells was arrested in the G₁ phase, 3.0% ± 1.3% in G₂, and 2.5% ± 0.4% in S. This result indicates that pirfenidone inhibited cell growth by arresting the HTFs in the G₁ phase. 

HTF Motility

Pirfenidone significantly reduced HTF motility at the concentrations of 0.15 and 0.3 mg/mL (Fig. 3) . All treated and untreated cells migrated during 24 hours of observation. At the concentration of 0 (control), 0.15, and 0.3 mg/mL, migration distances were 100%, 72.48% ± 0.79%, and 37.89% ± 1.21%, respectively; each had a statistically significant difference from the others (P < 0.05). 

Effects of Pirfenidone on Activated and Nonactivated FPCL Contraction

Exposure to pirfenidone at 0.15 and 0.3 mg/mL caused significant inhibition of contraction in both activated (P < 0.0001; Fig. 4A ) and nonactivated (P < 0.0001; Fig. 4B ) FPCLs after 7 days’ treatment, when compared with 0 mg/mL pirfenidone. At all concentrations of pirfenidone, the magnitudes of contraction were greater in activated cells than in their nonactivated counterparts (Fig. 4) . 

Toxicology of Pirfenidone

In a trypan blue exclusion test (Fig. 5) , after 24 hours of treatment, the percentages of living cells were 88.66% ± 3.57%, 90.03% ± 6.38%, 87.14% ± 11.68%, and 87.40% ± 11.57% for 0 (control), 0.15, 0.3, and 1 mg/mL pirfenidone, respectively. Likewise, with 72 hours of treatment, the living cells were 84.81% ± 2.29%, 87.18% ± 3.23%, 85.63% ± 4.42%, and 82.25% ± 6.91%, respectively. No statistically significant difference was found between treated and control cultures (P > 0.05). 

Effect of Pirfenidone on the Expression of TGF-βs

Our RT-PCR results (Fig. 6)are compatible with those from the Western blot analyses (Fig. 7) . Compared with the controls, there was significant downregulation of TGF-β1 and -β2, at the concentrations of 0.15 and 0.3 mg/mL (P < 0.05). A significant downregulation of TGF-β3 was seen only at the concentration of 0.3 mg/mL (P < 0.05). 

We further examined the distribution of the TGF-βs in HTFs using immunocytochemistry. Figure 8shows that all TGF isoforms were expressed in the cells. Staining of these isoforms decreased significantly after exposure to pirfenidone. Compatible with findings from RT-PCR and Western blot analyses, there was relatively weaker staining for TGF-β3 when compared with that for TGF-β1 and -β2; staining for TGF-β3 responded weakly to the exposure to pirfenidone. 

Discussion

Our study was driven by the need to find efficient antifibrotic agents with less toxicity, to prevent scarring after glaucoma filtration surgery. We explored the antifibrotic effect of pirfenidone on proliferation, migration, and collagen contraction of HTFs, a pivotal cell being implicated in glaucoma surgical wound healing. Our analyses showed that pirfenidone exhibits its inhibiting effects on HTFs in a dose-dependent manner. 

It is unlikely that the inhibiting roles of pirfenidone on HTFs are mediated by toxic effect. The use of pirfenidone in the human eye is likely to be safe, since the drug has been orally applied at a daily dosage of 1800 mg with minimal adverse effects in patients with pulmonary fibrosis. ¹⁷ Furthermore, our trypan blue exclusion test showed no change in viability in cells treated with pirfenidone compared with that in control cultures. We should be aware, however, that an in vitro experiment is insufficient for assessing the toxicity of pirfenidone. Our group is currently conducting a study in a rabbit model of glaucoma filtration surgery investigating the toxicity of pirfenidone compared with MMC. 

Pirfenidone is an anti-inflammatory and antifibrotic agent that exhibits its inhibitory effects on a host of cell types in vitro. Di Sario et al. ¹⁸ showed that pirfenidone significantly inhibits hepatic stellate cell proliferation, with a maximum effect at 1000 μM (0.19 mg/mL). Hewitson et al. ¹² suggested that the proliferation of rat renal fibroblasts is reduced by 0.02 to 0.2 mg/mL pirfenidone in a dose-dependent manner. Lee et al. ²² also demonstrated inhibiting effects of pirfenidone on myometrial and leiomyoma cells at doses ranging from 0 to 1.0 mg/mL. Apart from in vitro experiments and animal models, pirfenidone has been applied in several clinical trials ²³ of fibrotic disorders, including hypertrophic cardiomyopathy, pulmonary fibrosis, neurofibromatosis, uterine leiomyoma, and focal segmental glomerulosclerosis. 

Despite the widespread application of pirfenidone, its underlying mechanisms are not fully understood. The antifibrotic mechanisms of pirfenidone have been attributed to signaling regulation of several cytokines, such as TGF-β1, PDGF, TNF-α, and CTGF. In a bleomycin-induced model of lung fibrosis, pirfenidone has been shown to downregulate overexpression of TGF-β transcription, ¹¹ the lung procollagen I and III genes, ²⁴ and heat shock protein (HSP). ²⁵ In a rat liver fibrosis model of dimethylnitrosamine treatment, the antifibrotic effects of pirfenidone have been attributed to attenuation of procollagen α1(I), TIMP-1, and MMP-2. ²⁶ Pirfenidone has also been demonstrated to alter expression of interleukin(IL)-6 in rat models with acute pulmonary inflammation ²⁷ and to inhibit expression of intercellular adhesion molecule (ICAM)-1 in cultured human synovial fibroblasts. ²⁸  

To the best of our knowledge, we are the first to describe the potential mechanisms of pirfenidone in human Tenon’s fibroblasts. Using RT-PCR, Western blot, and immunocytochemistry analyses, we found that pirfenidone suppressed the mRNA and protein expression of TGF-β isoforms in a dose-dependent manner. A confocal laser scanning microscope showed that all three isoforms were expressed in the cytoplasm and nucleus, whereas TGF-β3 exhibited weaker expression in HTFs and accordingly responded less dramatically to the induction of pirfenidone. These findings suggest that the TGF-β1, -β2, and -β3 signaling pathways are likely to be involved in the antifibrotic mechanism of pirfenidone in HTFs. Nevertheless, how pirfenidone inhibits fibrosis and how TGF-βs are involved in this process await further investigation. 

TGF-βs are multifunctional peptides with fibrogenesis-promoting properties in cell proliferation, migration, contraction, differentiation, and apoptosis. ²⁹ As already stated, three TGF-βs—TGF-β1, -β2, and -β3—have been implicated in the process of fibrosis in human tissues. Because TGF-β isoforms are the key players in scarring after glaucoma filtration surgery, ²⁰ numerous efforts have been made to find drugs that can halt the TGF-β signaling pathway in the hope of preventing fibrosis. For example, decorin is a naturally occurring proteoglycan that has been found to inhibit TGF-β and to mediate wound healing in an experimental animal model. ³⁰ Both p38 inhibitors and Rho-dependent kinase (ROCK) inhibitors could block TGF-β-induced myofibroblast transdifferentiation and therefore prevent scar formation. ^{31 32} CAT-152 (Cambridge Antibody Technology, Cambridge UK), a recombinant human monoclonal antibody to human TGF-β2, has been demonstrated to have the potential to act against glaucoma postsurgical fibrosis. ³³ Although these agents have offered some promise, their clinical applications remain uncertain. In a phase III clinical trial, patients with glaucoma who received CAT-152 did not show a significant difference in bleb fibrogenesis compared with those who received the placebo control. ³³ One of the implications of this finding, the authors hypothesized, is that a monoclonal antibody applied against TGF-β2 is insufficient to cause complete inhibition. ³³ In other words, an agent that could halt a wide range of scar-enhancing factors, including all TGF-β isoforms, should be more effective. In this regard, pirfenidone represents a promising agent, as its antifibrotic effects are probably achieved via regulation of a variety of signaling pathways. 

In summary, in our study pirfenidone had inhibitory effects on proliferation, migration, and collagen contraction of HTFs. Its antifibrotic properties may be related to the regulation of TGF-β mRNA and protein expression. We propose that pirfenidone may be a promising antifibrotic agent in glaucoma filtration surgery. 

 Supported by Guangdong Science and Technology Fund Grant 20070407068.

 Submitted for publication September 2, 2008; revised October 22 and December 4, 2008; May 13, 2009.

 Disclosure: X. Lin, None; M. Yu, None; K. Wu, None; H. Yuan, None; H. Zhong, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Human Primer Sequences Used for RT-PCR and Probe Preparation

Gene	Accession No.*	Sense Primer	Antisense Primer	Probe (bp)
TGF-β1	NM_000660.3	GGGACTATCCACCTGCAAGA	CCTCCTTGGCGTAGTAGTCG	239
TGF-β2	NM_003238.1	GGAGGTGATTTCCATCTACAAC	TTCAGGCACTCTGGCTTTT	295
TGF-β3	NM_003239.1	CAAAGGGCTCTGGTGGTCC	CCGGGTGCTGTTGTAAAG	216

*  GenBank accession numbers are provided in the public domain by the National Center for Biotechnology Information and are available at www.ncbi.nlm.nih.gov/genbank.

Figure 1.

 

Proliferation of HTFs after exposure to pirfenidone as measured by MTT assay. Cells with 10% FCS were treated with 0, 0.01, 0.1, 0.2, 0.3, 0.5, or 1.0 mg/mL pirfenidone for 0, 12, 24, 48, or 72 hours. Data are derived from the mean ± SD of triplicate results in three independent experiments. *P < 0.05, and **P < 0.001 from comparisons between cells with treatment and control cells with 10% FCS, at different time points.

Figure 2.

 

Flow cytometric analysis of the cell cycle. Compared with the control group, pirfenidone arrested the cells at the G₁ phase in a concentration-dependent manner. As a result, the percentage of cells in the S phase decreased with increasing concentrations of pirfenidone, whereas the percentage of cells in the G₂ phase showed no differences among different concentrations of pirfenidone. Data are expressed as the mean ± SD of triplicates from three independent experiments. *P < 0.05.

Figure 3.

 

Effect of pirfenidone on HTF migration. Light microscope images showed decreased migratory ability of cells at 24 hours, after scratches were applied to the cells with 0, 0.15, or 0.3 mg/mL pirfenidone; each treated group had a statistically significant difference compared with the others (*P < 0.05). The suppression was most obvious at a concentration of 0.3 mg/mL. Data in each bar are the mean ± SD of cells that migrated through the membrane in three separate experiments. Magnification, ×40.

Figure 4.

 

Effects of pirfenidone on activated (A) and nonactivated (B) FPCLs. FPCLs exposed to treatment with 0 (▵), 0.15 (▪), or 0.3 (□) mg/mL pirfenidone. Control lattices contained no cells (○) and no cells exposed to 0.3 mg/mL pirfenidone (•). Data are expressed as the mean ± SD of results in three independent experiments.

Figure 5.

 

Effects of pirfenidone in a trypan blue exclusion test after 24- and 72-hour observation. Data are expressed as the mean ± SD of results in three independent experiments.

Figure 6.

 

Pirfenidone decreases mRNA expression of TGF-β1, -β2, and -β3 in HTFs. RT-PCR showed that pirfenidone reduced the levels of TGF-β1 (A), -β2 (B), and -β3 (C) when compared with control cells. *P < 0.05 versus the corresponding value for control cells. Data are the mean ± SD of triplicates from an experiment that was repeated with similar results.

Figure 7.

 

Expression of TGF-β1 (A), -β2 (B), and -β3 (C) induced by pirfenidone in HTF cells. Western blot showed that pirfenidone reduced the protein levels of TGF-1, -β2, and -β3 when compared with control cells. Data are mean ± SD of results from three independent cultures.

Figure 8.

 

Merged images of immunocytochemical detection of TGF-β1 (A), -β2 (B), and -β3 (C). Immunocytochemistry showed marked staining for TGF-β1 and -β2 in the cytoplasm and nuclei of HTFs (A ₁ , B ₁ ), and moderate staining after treatment with 0.15 (A ₂ , B ₂ ) and 0.3 mg/mL (A ₃ , B ₃ ) pirfenidone, respectively. Relatively moderate staining was present for TGF-β3 (C ₁ ), which showed a slight reduction after treatment with 0.15 (C ₂ ) and 0.3 mg/mL (C ₃ ) pirfenidone. (A ₀ , B ₀ , C ₀ ) Corresponding negative controls. Immunocytochemistry was performed with antibodies conjugated with CY3 (red). The cell nuclei were counterstained with Hoechst (blue). Scale bars, 20 μm. Magnification, ×1000.

The authors thank Qiang Huang, Shengsong Huang, and Yuhong Nie, Zhongshan Ophthalmic Center, for technical advice.