January 2010
Volume 51, Issue 1
Free
Glaucoma  |   January 2010
ACS67, a Hydrogen Sulfide–Releasing Derivative of Latanoprost Acid, Attenuates Retinal Ischemia and Oxidative Stress to RGC-5 Cells in Culture
Author Affiliations & Notes
  • Neville N. Osborne
    From the Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom;
  • Dan Ji
    From the Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom;
  • Aman S. Abdul Majid
    From the Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom;
  • Rebecca J. Fawcett
    From the Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom;
  • Anna Sparatore
    From the Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom;
    Dipartimento di Scienze Farmaceutiche “Pietro Pratesi” Università degli Studi di Milano, Milan, Italy; and
  • Piero Del Soldato
    From the Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom;
    CTG Pharma, Milan, Italy.
  • Corresponding author: Neville N. Osborne, Nuffield Laboratory of Ophthalmology, University of Oxford, John Radcliffe Hospital, Level 5/6, Headley Way, Oxford OX3 9DU, UK; neville.osborne@eye.ox.ac.uk
Investigative Ophthalmology & Visual Science January 2010, Vol.51, 284-294. doi:10.1167/iovs.09-3999
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Neville N. Osborne, Dan Ji, Aman S. Abdul Majid, Rebecca J. Fawcett, Anna Sparatore, Piero Del Soldato; ACS67, a Hydrogen Sulfide–Releasing Derivative of Latanoprost Acid, Attenuates Retinal Ischemia and Oxidative Stress to RGC-5 Cells in Culture. Invest. Ophthalmol. Vis. Sci. 2010;51(1):284-294. doi: 10.1167/iovs.09-3999.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: To determine the neuroprotective properties of a latanoprost acid derivative (ACS67) that donates the gas hydrogen sulfide (H2S).

Methods.: Ischemia to the rat retina was induced by elevation of intraocular pressure. Electroretinograms (ERGs) were recorded and the retinas analyzed 2 days later by immunohistochemistry, Western blot analysis, and RT-PCR. Hydrogen peroxide (H2O2) was used to impose an insult on RGC-5 cells in culture. The nature of the insult to cultures was quantified by the resazurin-reduction assay procedure, staining for reactive oxygen species (ROS) and for apoptosis. ACS67, its sulfurated moiety (ACS1), and latanoprost were tested for both their toxicity and ability to blunt the negative effect of H2O2 on RGC-5 cells. In addition, an assay was used to see whether any of the substances influenced glutathione (GSH) levels in RGC-5 cells.

Results.: Partial damage to the retina in situ after ischemia was characterized by an alteration of the ERG, a reduction in the retinal localization of specific antigens and a reduction and elevation of defined retinal proteins and mRNAs. Optic nerve axonal proteins were also drastically reduced by ischemia. Most of these changes were significantly blunted by an intravitreal injection of ACS67 directly after ischemia. ACS67, ACS1, and the antioxidant epigallocatechin gallate (EGCG) all stimulated GSH levels and significantly attenuated H2O2-induced toxicity to RGC-5 cells, whereas latanoprost did not.

Conclusions.: ACS67 acts as an H2S donor through its donating moiety ACS1 and as a consequence is able to act as a neuroprotectant.

One of the most potent agents used to lower intraocular pressure in the treatment of glaucoma is the prostaglandin latanoprost (isopropyl ester of latanoprost acid). 1 A derivative of this substance, ACS67, maintains the IOP effectiveness associated with latanoprost 2 but also releases H2S through its H2S-releasing moiety. 3 H2S, produced in biological tissues by cysteine, is now recognized as a signaling molecule that participates in many functions. 4,5 It is produced by the cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE) enzymes present in various tissues. 6 H2S is implicated in functions as diverse as inflammation, vasodilation, and neuronal survival. 4,5,7,8 Actual concentrations of H2S in human, rat, and bovine brain are significant and elicit biological effects at concentrations between 10 and 1000 μM. 4,911 H2S stimulates the formation of cAMP in neuronal cultures or glial cell lines, 12 is a regulator of the N-methyl-d-aspartate (NMDA) receptor, and is shown to play a part in long-term potentiation. 12,13 H2S regulates the activities of serotonergic neurons, 14 induces a release of corticotrophin-releasing hormones, 15 activates neuronal calcium channels, 16 increases intracellular glutathione levels, and affects smooth muscle relaxation and vasodilation by acting on KATP or Cl channels. 4,5,7  
H2S is a gas with wide-ranging cytotoxic effects, 10 and recent studies suggest that its negative effect is probably related to its concentration. In homogenates, H2S generation is between 1 and 10 picomoles/s/mg protein 17 ; and, given its rapid turnover, the extracellular active sulfide concentration is probably in the low micromolar range. 4 This may explain why agents that donate H2S have generally been found in culture studies to protect neurons and other cell types from oxidative stress 9,1822 or damage caused by β-amyloid to neurons. 23 Moreover, the effect of ischemia-reperfusion insults to the heart and liver are attenuated by H2S donors. 18,24,25 However, reports from other studies show that H2S can be toxic to brain neurons in culture 26 and that it exacerbates the negative effect of ischemia to the cerebral cortex. 27  
A derivative of latanoprost, ACS67, belongs to a class of compounds known as dithiolethiones (Fig. 1) which release H2S in a long-lasting controlled way. 3 Dithiolethione hybrids of diclofenac, 3,28,29 sildenafil, 30 and aspirin 31 have all been shown to maintain their endogenous properties but have additive effects associated with H2S. ACS67 is more effective than latanoprost in reducing IOP in rabbits as well as in stimulating cGMP and GSH levels. 2 The ability of ACS67 to increase GSH suggests that the compound has neuroprotective properties. The purpose of this study was therefore to test this hypothesis by deducing whether ACS67 attenuates the negative effect of an ischemic insult to the rat retina in situ. Moreover, studies were conducted on a transformed cell line that exhibited certain characteristics associated with ganglion cells to determine whether ACS67 stimulated the production of glutathione and/or counteracted the influence of oxidative stress induced by H2O2
Figure 1.
 
A comparison of the structural differences between latanoprost, ACS1, and ACS67. ACS67 is a dithiolethione (ACS1) hybrid together with latanoprost. The dithiolethione molecule generates H2S once in a cell.
Figure 1.
 
A comparison of the structural differences between latanoprost, ACS1, and ACS67. ACS67 is a dithiolethione (ACS1) hybrid together with latanoprost. The dithiolethione molecule generates H2S once in a cell.
Materials and Methods
Animal procedures conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, as approved by the Home Office in the United Kingdom. Rats were housed in a 12-hour light–dark cycle and were provided food and water ad libitum. Adult animals were anesthetized with an intramuscular injection (Hypnorm; Janssen, Grove, UK; 0.3 mL/kg; and diazepam 2.5 mg/kg; CP Pharmaceuticals Ltd., Wrexham, UK) and their ERGs were recorded from both eyes. Chemicals and reagents were from Sigma Chemical Company (Poole, UK). ACS67 and ACS1 were prepared as previously described. 3  
Induction of Retinal Ischemia.
Ischemia was induced by inserting a 30-gauge needle, connected to a sterile saline reservoir at a certain height, into the anterior chamber of one eye to produce an IOP (determined before use of a mercury manometer) of 120 mm Hg. Ischemia was confirmed by immediate whitening of the fundus which lasted for 50 minutes. Normal body temperature was maintained and monitored both during ischemia and in the recovery period before transfer to animal house conditions. In some instances, 5 μL of ACS67 (4 nM) or vehicle (50% DMSO) was injected into the vitreous humor via the limbus directly after ischemia, and these animals were killed after 7 days of reperfusion. Retinas and optic nerves were dissected and analyzed for levels of defined mRNAs and proteins. In some instances, the retinas were fixed and processed for immunohistochemistry. 
Electroretinography.
ERGs from both eyes were recorded 2 to 3 days before and 5 days after ischemia. The animals were initially dark adapted for at least 6 hours before their flash ERGs were recorded. Pupils were dilated with 1% tropicamide (Smith and Nephew Pharmaceuticals Ltd., Romford, UK) and 2.5% phenylephrine (Smith and Nephew Pharmaceuticals Ltd.). A platinum electrode was placed in contact with the cornea and a reference electrode through the tongue; a grounding electrode was attached to the scruff of the neck. All procedures were performed in dim red light, and the rats were kept warm during and after the procedure. The responses to a 2500 cd/m2 white light flash (10 μs, 0.1 Hz) from a photic stimulator (model PS33-plus; Grass Instrument Divisions, West Warwick, UK) were amplified and averaged by using a 1902 Signal Conditioner/1401 Laboratory Interface; CED, Cambridge, UK). The amplitude of the a-wave was measured from the baseline to the maximum a-wave trough and the b-wave was measured from the maximum a-wave trough to the maximum b-wave peak. Data were analyzed by the Student's unpaired t-test, and P < 0.05 was considered significant. 
Immunohistochemistry.
Freshly dissected retinas 7 days after ischemia were fixed in 2% paraformaldehyde for 40 minutes and 10-μm frozen retinal sections produced. Sections were subsequently incubated overnight at 4°C with sheep anti-nNOS antibody (diluted 1:100; donated by Piers Emson, Cambridge University, Cambridge, UK), rabbit anti-GFAP polyclonal antibody (diluted 1:1000; Dako, Ely, UK) or mouse monoclonal anti-Thy-1 monoclonal antibody (clone OX-7, diluted 1:30; a gift of the Dunn School of Pathology, Oxford University, Oxford, UK) and developed with appropriate secondary antibodies conjugated to fluorescein. 32  
RT-PCR Procedure.
The levels of cyclophilin, Thy-1, NF-L, PARP, GFAP, caspase 3, and caspase 8 mRNAs were determined in the retina from rats seven days after ischemia with semiquantitative RT-PCR, as described previously. 33,34 Briefly, total RNA was isolated, and first-strand cDNA synthesis was performed on 2 μg DNase-treated RNA. The individual cDNA species were amplified in a reaction containing an aliquot of cDNA; PCR buffer, 5 mM MgCl2 for NF-L, caspase 3, and caspase 8, and 4 mM MgCl2 for all other primers; dNTPs; the relevant primer pairs; and DNA polymerase. Reactions were initiated by incubating at 94°C for 10 minutes and PCRs (94°C, 15 seconds; 52°C, 55°C, or 56°C, 30 seconds; and 72°C, 30 seconds) performed for a suitable number of cycles (26–28 cycles except in the case of caspase 8 for which the number of cycles was between 32 and 35), followed by a final extension at 72°C for 3 minutes. Interexperimental variation was avoided by performing all amplifications in a single run. PCR reaction products were separated on 1.2% agarose gels with ethidium bromide for visualization. The relative abundance of each PCR product was determined by quantitative analysis of digital photographs of gels (Labworks software; UVP Products, Upland, CA). The sequence and annealing temperatures of the primers used (Gibco Life Technologies, Paisley, Scotland, UK) are shown in Table 1
Table 1.
 
Primer Sequences
Table 1.
 
Primer Sequences
Primers Sequences Annealing Temp (°C) Accession Number
Caspase-3 TACCCTGAAATGGGCTTGTGT 52 BC081854
GTTAACACGAGTGAGGATGTG
Caspase-8 ACTGGCTGCCCTCAAGTTCCTGTGC 60 AF279308
TCCCTCACCATTTCCTCTGGGCTGC
Cyclophilin TGGTCAACCCCACCGTGTTCTTCG 52 M19533
GTCCAGCATTTGCCATGGACAAGA
GFAP ATTCCGCGCCTCTCCCTGTCTC 55 U03700
GCTTCATCCGCCTCCTGTCTGT
NF-L ATGCTCAGATCTCCGTGGAGATG 52 AF031880
GCTTCGCAGCTCATTCTCCAGTT
PARP-1 CCTAAGGAGATTCGGTGAG 52 NM_013063
GGCAAGCACAGTGTCAAA
Thy-1 CGCTTTATCAAGGTCCTTACTC 52 X03150
GCGTTTTGAGATATTTGAAGGT
Before semiquantitative amplification of the experimental samples, the amount of cDNA in all the samples was equalized. In addition, the optimal conditions (e.g., Mg2+ concentration and annealing temperature) for each set of primers were determined. Subsequently, cycle-dependent reactions were performed for each mRNA species to determine the linear range of detection by ethidium bromide. Once the linear range was established, PCRs were performed at the lowest cycle number that provided a reliable detectable product. To minimize variability, duplicate runs were performed for each mRNA amplified and the data were averaged. 
For assessment of the levels of the various mRNAs in the retina, all values were normalized to that of the housekeeping gene cyclophilin. Thus, cyclophilin acted as an internal standard to correct for any variations in RNA isolation and/or cDNA synthesis. 
Electrophoresis and Western Blot Analysis.
Optic nerves (6–8 mm long) or retinas from rats 7 days after ischemia were sonicated in 100 μL homogenization buffer (20 mM Tris/HCl [pH 7.4], containing 2 mM EDTA, 0.5 mM EGTA, 1% SDS, 0.1 mM phenylmethylsulfonyl fluoride, 50 μg/mL aprotinin, 50 μg/mL leupeptin, and 50 μg/mL pepstatin A) to which an equal volume of sample buffer (62.5 mM Tris/HCl [pH 7.4], containing 4% SDS or sodium dodecyl sulfate, 10% glycerol, 10% mercaptoethanol, and 0.002% bromophenol blue) was added. Optic nerve and retinal samples were boiled for 3 minutes and an aliquot analyzed for total protein content with a bicinchoninic acid protein kit (Sigma-Aldrich). 
Retinal proteins from tissues 7 days after ischemia were separated and isolated from RNA (TriReagent kit; Sigma-Aldrich). Proteins from individual retinas were then solubilized in 200 μL of homogenization buffer/protease inhibitors solution to which an equal volume of sample buffer was added. 
Equal amounts of proteins were fractionated by electrophoresis with 10% polyacrylamide gels containing 0.1% SDS, as described by Laemmli. 35 Proteins were transferred to nitrocellulose and blots were incubated for 3 hours at room temperature with various primary antibodies. Detection was then performed with appropriate biotinylated secondary antibodies. The final nitrocellulose blots were developed with a 0.016% wt/vol solution of 3-amino-9-ethylcarbazole (AEC) in 50 mM sodium acetate (pH 5.0) containing 0.05% (vol/vol) Tween-20 and 0.03% (vol/vol) H2O2. The colorimetric reaction was stopped with 0.05% sodium azide solution, the blot was scanned at 800 dpi (Perfection 1200u scanner; Epson Ltd., Hemel Hempstead, UK), and quantitative analysis of the detected proteins was performed (Labworks software; UVP Products). 
Primary antibodies used were as follows: PARP-1 (1:1000; BD Biosciences, Oxford, UK), actin (1:2000; Chemicon, Chandler's Ford, UK), tubulin (1:1000; Chemicon), GFAP (diluted 1:5000; Dako, UK), and neurofilament 70 kDa (NF-L; 1:2000; Chemicon). All were all anti-mouse except for GFAP. 
Cell Culture Studies.
Transformed neural precursor cells known to exhibit a number of biochemical characteristics associated with retinal ganglion cells (RGC-5 cells) were the kind gift of Neeraj Agarwal (UNT Health Science Center, Fort Worth, Texas). They were maintained in Dulbecco's modified Eagle's medium (D-MEM; Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS; Invitrogen, Paisley, Scotland, UK) 25 mM glucose, 100 U/mL penicillin (Invitrogen), and 100 μg/mL streptomycin (Invitrogen) in a humidified atmosphere of 95% air and 5% CO2 at 37°C. Doubling time of these cells was approximately 20 hours. Confluent cultures of RGC-5 cells from 75-cm2, filter-capped cell culture flasks were generally passaged at a ratio of approximately 1:8 to give a cell density of approximately 4 to 5 × 104 cells/mL. One hundred microliters of these cells was plated onto 96-well plates (CellPlus; Sarstedt, St. Laurent, QC, Canada) or 500 μL of cells was plated onto sterilized borosilicate glass coverslips on 24-well plates. 
After approximately 5 hours to allow the cells to settle, 200 μM H2O2 was added to each well. In some instances ACS67, latanoprost (Sigma), or epigallocatechin gallate EGCG (Sigma) was added 30 minutes before H2O2. The cells in 96-well plates were analyzed 24 hours later for viability (resazurin reduction assay [RRA], Promega, Madison, WI) or for apoptosis (APOPercentage kit; Biocolor, Belfast, Northern Ireland, UK). Coverslips of the cells in 24-well plates were processed at the same time for the localization of ROS with the dye 2′,7′-dihydroethidium and cell death with Hoechst 33258 (Sigma-Aldrich). 
Resazurin Reduction Assay (RRA).
The RRA was performed with a kit from Promega. The assay is based on the ability of living cells to convert the redox dye into a florescent product (resorufin; excitation 530 nm, emission 590 nm). 36,37  
Identification of Apoptosis.
This assay was performed as described by the manufacturer (Biocolor Ltd., Belfast, Northern Ireland, UK). Briefly, 5 μL of the dye was added to the cells in each well of a 96-well plate and incubated for 30 minutes at 37°C. The medium was then removed and the cells were washed twice with PBS before viewing by light microscopy. 
Localizing Apoptotic Cells with Hoechst.
Cells were fixed in 4% paraformaldehyde and incubated with Hoechst 33258 dye (2.5 μg/mL dissolved in distilled water) for 30 minutes at room temperature. Cells with intensely stained nuclei caused by Hoechst affinity for fragmented DNA were defined as cells in the process of apoptosis. 
Localization of ROS.
The dye 2′,7′-dihydroethidium (DHE) was oxidized by superoxide and H2O2 and was used to localize ROS. 38 DHE is nonfluorescent and can passively cross the membrane of live cells. Within the cells, DHE was oxidized by superoxide anion or H2O2 to generated ethidium bromide, which binds to DNA and, when excited, emits red fluorescence that is proportional to the intracellular superoxide anion level. After different treatments, DHE (10μg/mL) was added to the culture medium and maintained in the incubator for 30 minutes at 37°C. The coverslips containing the cells were then fixed with 4% paraformaldehyde for 20 minutes. After the coverslips were washed in PBS, they were mounted in PBS containing 1% glycerol, and ROS was detected by intense red fluorescence with an epifluorescence microscope (Carl Zeiss Meditec, Oberkochen, Germany). 
Assay of Glutathione.
The assay is based on glutathione-S-transferase (GST) reacting with GSH+monochlorobimane (mCB) to form the fluorescent product bimane-glutathione. 39 Briefly, after maintaining cell cultures in 40-mm wells in the presence of different substances for 8 hours approximately 1 × 106 RGC-5 cells (collected from two 40 mm wells) were collected and centrifuged at 700g for 10 minutes at 4°C. The pelleted cells were then resuspended in cell lysis buffer (100 μL) and after 10 minutes centrifuged at 10,100g for 10 minutes. Supernatant samples (20 μL) were transferred to a microplate, and, to each sample, 2 μL 20 mM mCB and 4 μL of GST 25 U/mL was added. After incubation at 37°C for 15 minutes, fluorescence was measured in a plate reader where the excitation and emission spectra were 380 and 460 nm, respectively. 
Statistical Analysis.
Data, unless stated otherwise, were analyzed for significance with a one-way analysis of variance (ANOVA) followed by a Tukey multiple-comparison test and are expressed as a mean percentage of the control value ± SEM. P < 0.05 was considered significant. 
Results
Effect of ACS67 on Retinal Ischemia-Reperfusion
Elevated IOP-induced ischemia for 50 minutes followed by 5 days of reperfusion caused, on average, a 36% and 63% reduction in the a- and b-wave amplitudes, respectively, in ACS67-treated rats (n = 14). In animals treated with vehicle (n = 14), the reduction in the a- and b-wave amplitudes was approximately 49% and 76%, respectively. The differences in amplitudes of both the a- and b-waves between the two groups of animals were significant. Neither ACS67 nor its vehicle (DMSO) affected the ERG recordings of untreated (nonischemic) eyes (Fig. 2). 
Figure 2.
 
In these studies, ERGs from both eyes were recorded. One eye was subsequently given ischemia. Five days later, the ERGs from the ischemic and nonischemic eyes were recorded and the percentage changes in the a- and b-wave amplitudes were compared between the ischemic and control eyes. Both the a- and b-wave amplitudes of the ERG were clearly reduced by ischemia-reperfusion (***P < 0.001 compared with control). Moreover, compared with vehicle, ACS67 significantly attenuated the reduction of the a- and b-wave amplitudes (**P < 0.01 compared with ischemia). Results are the mean ± SEM, n = 14.
Figure 2.
 
In these studies, ERGs from both eyes were recorded. One eye was subsequently given ischemia. Five days later, the ERGs from the ischemic and nonischemic eyes were recorded and the percentage changes in the a- and b-wave amplitudes were compared between the ischemic and control eyes. Both the a- and b-wave amplitudes of the ERG were clearly reduced by ischemia-reperfusion (***P < 0.001 compared with control). Moreover, compared with vehicle, ACS67 significantly attenuated the reduction of the a- and b-wave amplitudes (**P < 0.01 compared with ischemia). Results are the mean ± SEM, n = 14.
Ischemia for 50 minutes followed by 7 days of reperfusion caused a change in the content of selected retinal and optic nerve proteins as shown in Figures 3 and 4. These data show that ischemia-reperfusion significantly decreased the protein level of NF-L but increased the level of PARP and GFAP proteins in the retina (Fig. 3). Of importance, the changes in protein levels of NF-L, PARP, and GFAP induced by ischemia were attenuated by ACS67 treatment by 13%, 28%, and 24%, respectively (Fig. 3). In addition, NF-L and tubulin proteins in the optic nerve were found to decrease by 54% and 42%, respectively, after ischemia-reperfusion (Fig. 4). The decrease in optic nerve NF-L and tubulin proteins caused by ischemia-reperfusion was significantly nullified in rats treated with ACS67, where the decrease in NF-L and tubulin proteins was 22% and 20%, respectively (Fig. 4). 
Figure 3.
 
NF-L (A), GFAP (B), and PARP (C) proteins relative to actin in the nonischemic retina (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant change in the amounts of NF-L, GFAP, and PARP proteins compared with the control (***P < 0.001). However, treatment with ACS67 significantly (**P < 0.01) blunted this effect. ACS67 reduced the change in NF-L, GFAP, and PARP proteins caused by ischemia by 14%, 24%, and 28%, respectively. Data are expressed as the mean; error bar, ± SEM (n = 12).
Figure 3.
 
NF-L (A), GFAP (B), and PARP (C) proteins relative to actin in the nonischemic retina (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant change in the amounts of NF-L, GFAP, and PARP proteins compared with the control (***P < 0.001). However, treatment with ACS67 significantly (**P < 0.01) blunted this effect. ACS67 reduced the change in NF-L, GFAP, and PARP proteins caused by ischemia by 14%, 24%, and 28%, respectively. Data are expressed as the mean; error bar, ± SEM (n = 12).
Figure 4.
 
Tubulin (A) and NF-L (B) proteins relative to actin in the nonischemic optic nerves (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant (***P < 0.001) decrease in both NF-L and tubulin proteins. ACS67 treatment significantly (**P < 0.01) attenuated the reduction of tubulin and NF-L proteins by 21% and 33%, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12).
Figure 4.
 
Tubulin (A) and NF-L (B) proteins relative to actin in the nonischemic optic nerves (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant (***P < 0.001) decrease in both NF-L and tubulin proteins. ACS67 treatment significantly (**P < 0.01) attenuated the reduction of tubulin and NF-L proteins by 21% and 33%, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12).
Ischemia for 50 minutes followed by 7 days of reperfusion also caused changes in the content of selected mRNAs. The mRNA levels (normalized to cyclophilin) of Thy-1 and NF-L in vehicle-treated rat retinas were significantly reduced (Figs. 5). In contrast, the mRNA levels of caspase 3, caspase 8, PARP, and GFAP were clearly elevated (Figs. 6, 7). The reduction of Thy-1 and NF-L caused by ischemia was significantly less, 19% and 21%, respectively, when ACS67 was injected into the eye after ischemia. ACS67 treatment, however, did not affect the increased mRNA levels of caspase 8, caspase 3, or PARP caused by ischemia but blunted the increase in GFAP mRNA by 31%. 
Figure 5.
 
NF-L and Thy-1 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused a significant decrease in the mRNA level in vehicle-treated animals. These changes were significantly blunted by treatment with ACS67 by 21% and 19% for NF-L and Thy-1, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01, ***P < 0.001).
Figure 5.
 
NF-L and Thy-1 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused a significant decrease in the mRNA level in vehicle-treated animals. These changes were significantly blunted by treatment with ACS67 by 21% and 19% for NF-L and Thy-1, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01, ***P < 0.001).
Figure 6.
 
Caspase 3 and -8 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals, but these changes were not significantly blunted by treatment with ACS67. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01).
Figure 6.
 
Caspase 3 and -8 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals, but these changes were not significantly blunted by treatment with ACS67. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01).
Figure 7.
 
GFAP and PARP mRNA levels relative to cyclophilin mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals but these changes were only significantly blunted for GFAP (31%) by treatment with ACS67. Data are expressed as the mean. Error bars, ±SEM (n = 12 in each case, ***P < 0.001, *P < 0.05).
Figure 7.
 
GFAP and PARP mRNA levels relative to cyclophilin mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals but these changes were only significantly blunted for GFAP (31%) by treatment with ACS67. Data are expressed as the mean. Error bars, ±SEM (n = 12 in each case, ***P < 0.001, *P < 0.05).
Analysis of retinal tissues from vehicle-treated animals for the localization of nNOS (neuronal nitric oxide synthase), GFAP, and Thy-1 immunoreactivity 7 days after ischemia showed clear changes compared with the controls. Normal Thy-1 staining in the retinas of the rats was associated with the ganglion cell layer and the whole of the inner plexiform layer (Fig. 8A). Normal nNOS immunoreactivity was associated with certain amacrine cells and their processes appeared as three defined bands in the inner plexiform layer (Fig. 8D). Normal GFAP immunoreactivity was primarily associated with astrocytes and end feet of Müller cells in the ganglion cell and nerve fiber layers (Fig. 8G). Ischemia-reperfusion in vehicle-treated eyes caused a significant thinning of Thy-1 immunoreactivity (Fig. 8B), a marked elimination of nNOS immunoreactivity (Fig. 8E), and an intense staining of GFAP in Müller cells throughout the retina (Fig. 8H). In contrast, in the ischemia/ACS67-treated rats, the reduction of Thy-1 and nNOS immunoreactivity was less pronounced (Figs. 8C, 8F), and the enhancement of GFAP staining was clearly reduced (Fig. 8I). This conclusion was reached after analysis of many retinal sections from areas of the retina that were of similar eccentricity. 
Figure 8.
 
A summary of the information obtained from the analysis of retinas from six rats in which ischemia was induced in one eye in each case followed by intravitreal injection of either vehicle or ACS67. Ischemia-reperfusion caused a clear change in the thickness of the Thy-1 immunoreactivity (B) in the inner plexiform layer (IPL), and almost a complete loss of the nNOS immunoreactive amacrine cells (E) and distinctive strong staining of GFAP (thick arrows, H) associated with retinal Müller cells. The effect of ischemia on the localization of retinal Thy-1, nNOS, and GFAP immunoreactivity were attenuated in animals treated with ACS67 (C, F, I). (A) The broad band of Thy-1 immunoreactivity in the IPL of a control retina. (D) The nNOS immunoreactive neurons (thin arrows) and three bands of immunoreactivity (1, 2, 3) in the IPL in control retina. GFAP in the control retina (G) and in the retinas given ischemia-reperfusion where the animals were treated with ACS67 (I) was sparsely associated with Müller cells (thin arrows) and more densely associated with the nerve fiber layer.
Figure 8.
 
A summary of the information obtained from the analysis of retinas from six rats in which ischemia was induced in one eye in each case followed by intravitreal injection of either vehicle or ACS67. Ischemia-reperfusion caused a clear change in the thickness of the Thy-1 immunoreactivity (B) in the inner plexiform layer (IPL), and almost a complete loss of the nNOS immunoreactive amacrine cells (E) and distinctive strong staining of GFAP (thick arrows, H) associated with retinal Müller cells. The effect of ischemia on the localization of retinal Thy-1, nNOS, and GFAP immunoreactivity were attenuated in animals treated with ACS67 (C, F, I). (A) The broad band of Thy-1 immunoreactivity in the IPL of a control retina. (D) The nNOS immunoreactive neurons (thin arrows) and three bands of immunoreactivity (1, 2, 3) in the IPL in control retina. GFAP in the control retina (G) and in the retinas given ischemia-reperfusion where the animals were treated with ACS67 (I) was sparsely associated with Müller cells (thin arrows) and more densely associated with the nerve fiber layer.
Studies on RGC-5 Cells in Culture
Figures 9, 10, and 11 show data from RRA viability assays in which RGC-5 cells in culture media were exposed to ACS67, ACS1, or latanoprost (all between 1 and 50 μM) or vehicle (DMSO) for 24 hours. It is clear that, even at 20 μM, ACS67 and ACS1 had no effect on cell survival. In contrast, latanoprost at concentrations greater than 10 μM was toxic. Since it has been shown in previous studies that the viability of RGC-5 cells is dose dependently reduced by H2O2 over a 24-hour period of exposure, 40,41 it was decided in the present experiments to impose an in insult on RGC-5 cells with 200 μM H2O2. This insult resulted in approximately 30% loss of cell viability over a 24-hour period (Fig. 9). 
Figure 9.
 
The effect of different concentrations of ACS1 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 9.
 
The effect of different concentrations of ACS1 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 10.
 
The effect of different concentrations of ACS67 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 10.
 
The effect of different concentrations of ACS67 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 11.
 
The effect of different concentrations of latanoprost in the absence or presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM; (n = 6; **P < 0.01, ***P < 0.001).
Figure 11.
 
The effect of different concentrations of latanoprost in the absence or presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM; (n = 6; **P < 0.01, ***P < 0.001).
With the RRA assay, it was found that ACS1 (Fig. 9) and ACS67 (Fig. 10) counteracted dose dependently the negative effect of 200 μM H2O2 on RGC-5 cells between 10 and 50 μM and 5 and 20 μM, respectively. In contrast, no evidence was found of latanoprost's blunting the negative effect of H2O2, and it was toxic at 10 μM (Fig. 11). EGCG at 50 μM was also used for comparative purposes as it is known to blunt the negative effect of H2O2 on RGC-5 cells. 40 Staining of dead cell nuclei in cultures with Hoechst 33258 dye confirmed that ACS67 and EGCG attenuate H2O2-induced toxicity to RGC-5 cells (Fig. 12). It is clear in Figure 12 that the number of stained nuclei induced by H2O2 toxicity were much reduced in the presence of 10 μM ACS67 or 50 μM EGCG. 
Figure 12.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Staining of cultures was by use of Hoechst, which reveals damaged DNA (arrows) as an indicator of apoptosis. Several cells stained for apoptosis after H2O2 treatment (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A).
Figure 12.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Staining of cultures was by use of Hoechst, which reveals damaged DNA (arrows) as an indicator of apoptosis. Several cells stained for apoptosis after H2O2 treatment (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A).
Further support of the effectiveness of ACS67 as a neuroprotectant was provided by staining of cultures for apoptosis (APOPercentage method; Biocolor; Fig. 13). After exposure to 200 μM H2O2, several cells died by apoptosis, as evidenced by membrane changes resulting in the staining of phosphatidylserine. It can be seen in Figure 13 that 10 μM ACS67 or 50 μM EGCG blunted the effect of H2O2, with ACS67 being more effective. Cells were also stained for ROS (Fig. 14) detected in cell nuclei after H2O2 insult. This H2O2-induced production of ROS is significantly reduced by 10 and 50 μM of ACS67 and EGCG, respectively. 
Figure 13.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Cultures were stained with an apoptosis-detection kit that revealed membrane phosphatidylserine (arrows) as an indicator for apoptosis. Some cells showed staining for apoptosis after H2O2 treatment, (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A). Quantitative data after the analysis of four separate cultures where apoptotic cells were counted in five randomly chosen fields in each case are also shown. **P < 0.01, ***P < 0.001.
Figure 13.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Cultures were stained with an apoptosis-detection kit that revealed membrane phosphatidylserine (arrows) as an indicator for apoptosis. Some cells showed staining for apoptosis after H2O2 treatment, (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A). Quantitative data after the analysis of four separate cultures where apoptotic cells were counted in five randomly chosen fields in each case are also shown. **P < 0.01, ***P < 0.001.
Figure 14.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 generation of ROS induced by exposure to H2O2 (200 μM) for 24 hours (B). (A) A control untreated culture. The yellow staining of nuclei reflects the intracellular generation of ROS. A large number of cells showed intense staining for ROS (arrows) after H2O2 treatment (B), and this reaction was blunted partially and almost completely by EGCG (C) and ACS67 (D), respectively.
Figure 14.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 generation of ROS induced by exposure to H2O2 (200 μM) for 24 hours (B). (A) A control untreated culture. The yellow staining of nuclei reflects the intracellular generation of ROS. A large number of cells showed intense staining for ROS (arrows) after H2O2 treatment (B), and this reaction was blunted partially and almost completely by EGCG (C) and ACS67 (D), respectively.
Exposure of RGC-5 cells to ACS67 (1 and 10 μM), ACS1 (1 and 10 μM), EGCG (100 μM), or latanoprost (10 μM) for 8 hours showed that ACS67, ACS1, and EGCG caused a significant elevation of measured GSH, whereas latanoprost was without effect (Fig. 15). Of interest was the finding that the lower concentrations of ACS67 and ACS1 (1 μM) were more effective than a 10-times greater concentration in causing an elevation of GSH in RGC-5 cells. 
Figure 15.
 
Relative amounts of GSH fluorescence in RGC-5 cultures after exposure to ACS1, ACS67, EGCG, and latanoprost (LATAN) after 8 hours when compared with untreated control cultures. Results are expressed as the mean; error bars, ±SEM (n = 4; ***P < 0.001).
Figure 15.
 
Relative amounts of GSH fluorescence in RGC-5 cultures after exposure to ACS1, ACS67, EGCG, and latanoprost (LATAN) after 8 hours when compared with untreated control cultures. Results are expressed as the mean; error bars, ±SEM (n = 4; ***P < 0.001).
Discussion
In this study, ACS67, a derivative of latanoprost acid, acted as a neuroprotectant counteracting an ischemic–reperfusion insult to the retina and an oxidative insult to RGC-5 cells in culture. As shown in Figure 1, ACS67 is an ester of latanoprost acid containing dithiolethione (ACS1) and is likely to be hydrolyzed in vitro or in vivo to the parent compounds. ACS1 has been demonstrated to release H2S in vitro when incubated with rat liver homogenates. 3 Moreover, ACS1 esters containing diclofenac (ACS15) or aspirin (ACS14) are known to release H2S in vitro and in vivo. 2,31 We therefore propose that the neuroprotective action of ACS67 is due to the H2S release from the sulfurated moiety as found for ACS1, ACS14, and ACS15. Moreover, the finding that ACS67 stimulates the production of GSH in cultured cells (Fig. 15) and in the aqueous humor when applied topically to the rabbit eye 2 provides support for this notion. H2S is known to stimulate GSH formation 9,42 as well as other processes that could contribute to a neuroprotective action. 5,19  
This study provided electrophysiological, immunohistochemical, and biochemical data to show that ACS67 counteracted an insult of ischemia-reperfusion to the retina in situ. We conclude that this is because of the release of H2S released from ACS67, although this requires confirmation, as already demonstrated for diclofenac (ACS15) and aspirin (ACS14). Significantly, H2S has been shown to attenuate the effects of ischemia to tissues, such as the heart and liver, 4,18,24,25 but not to the brain, where it exacerbates the insult. 27 This study is therefore the first to conclude that H2S blunts the influences of ischemia-reperfusion to central nervous system (CNS) tissue. Ischemia to the retina was induced by elevation of the IOP above the systolic blood pressure for 50 minutes and vehicle or ACS67 injected into the vitreous humor. Of importance, the reduction of the a- and b-wave amplitudes of ERGs in vehicle-treated rats was significantly greater than in animals treated with ACS67. Thus, the electrophysiological data suggest that physiological damage to the retina induced by ischemia-reperfusion is attenuated by ACS67. 43  
In the model of ischemia-reperfusion used in this study, it is known that the inner retina is particularly affected 44 as demonstrated in this study by a reduction in nNOS and Thy-1 immunoreactivity in different subsets of amacrine and ganglion cells in the inner retina. In contrast, GFAP immunoreactivity in glial cells was clearly enhanced by the insult. It should be emphasized that it is important for sections of similar eccentricities to be compared when making comparisons between different retinas. However, by comparing sections from approximately the same retinal areas in a masked fashion, it is possible to make an informed judgment. We concluded that nNOS, Thy-1, and GFAP immunoreactivity are much affected by ischemia-reperfusion and that the changes are blunted by intravitreal administration of ACS67. 
Analysis of the level of retinal mRNAs and proteins in the retina and optic nerve of rats subjected to ischemia corroborated the data derived by immunohistochemistry and electrophysiology. The degree of ganglion cell death after ischemia-reperfusion was determined by relating the protein (NF-L) and mRNA (Thy-1 and NF-L) levels of ganglion cell–specific markers with total actin protein and cyclophillin mRNA levels, respectively, in each retinal sample. The validity of this method of obtaining information on ganglion cell death is documented in various publications. 33,34,45 The results show that ischemia-reperfusion has a drastic effect on ganglion cells, causing a large decrease in NF-L mRNA/protein and Thy-1 mRNA levels. This effect is significantly blunted by injection of ACS67. 
NF-L and tubulin proteins are present in ganglion cells and analysis of their levels in the optic nerve provides a measure of ganglion cell viability. 46,47 Ischemia-reperfusion clearly reduces the levels of tubulin and NF-L proteins in the optic nerve, as well as NF-L in the retina, which are significantly blunted by ACS67. Thus, ischemia-reperfusion causes both a reduction in retinal mRNA/proteins and optic nerve proteins associated with ganglion cells and this effect is nullified by intravitreal injection of ACS67. 
GFAP is associated with retinal glial (astrocytes and Müller cells), and when these cells are activated by ischemia, the expression of GFAP is upregulated. 48 It remains unknown exactly why this occurs. In these studies, GFAP protein and mRNA are upregulated after ischemia-reperfusion. This finding is consistent with our present immunohistochemical results and with other published data showing that GFAP immunoreactivity in retinal Müller cells is enhanced after ischemia-reperfusion. 4850 Significantly, ACS67 attenuates ischemia-reperfusion–induced upregulation of Müller cell GFAP protein and mRNA. 
Various studies have shown that retinal neuronal death caused by ischemia-reperfusion occurs by apoptosis. 44,51 Evidence of cell death was substantiated in the present study, where it was shown that caspase 3 mRNA, caspase 8 mRNA, and PARP mRNA/protein were upregulated in the retina after ischemia-reperfusion. During apoptosis, caspase 3, caspase 8, and PARP are known to be upregulated. 5255 The finding that ACS67 significantly attenuated the upregulation of PARP protein caused by ischemia-reperfusion provides further evidence that ACS67 is a neuroprotective agent. It is difficult to explain the lack of effect of ACS67 on the upregulation of caspase 3, caspase 8, and PARP mRNAs caused by ischemia-reperfusion. A possible explanation is that ischemia-reperfusion caused too great an elevation of caspase 3 and -8 and PARP mRNAs and that the positive influence of ACS67 was not sufficient to be detected. 
With the transformed neuronal precursor cell line (RGC-5), 56 we showed H2O2-induced cell apoptosis to be attenuated by ACS67, ACS1, and EGCG. In contrast, latanoprost was ineffective. Oxidative stress caused by H2O2 and apoptosis was indicated by an increase in intracellular ROS and the staining of cell membranes for phosphatidylserine or DNA (APOPercentage; [Biocolor] or Hoechst dye, respectively). These data are consistent with our view that the neuroprotective effect of ACS67 and ACS1 is caused specifically by the release of H2S from the molecule. In contrast, although EGCG is known to attenuate the negative effect of H2O2 to RGC-5 cells, 57 it has not been suggested to date that the neuroprotective action of EGCG involves such a process. 58 It has been demonstrated that H2S is effective in counteracting an insult of oxidative stress on cells in culture. 19,22,42 In our results, ACS67, ACS1, and EGCG stimulated GSH formation in RGC-5 cells. It is known that EGCG can affect GSH metabolism, but how this occurs remains undefined. 5962 In contrast, there is evidence to suggest that intracellular cysteine levels are enhanced indirectly to form GSH by H2S stimulation of glutamate/cysteine antiporters and γ-glutamylcysteine activity. 9 We therefore suggest that H2S released from ACS67 or ACS1 is the cause of the elevation of GSH in RGC-5 cells that occurred in our study within an 8-hour period. Of importance, in analyses was conducted after 24 hours, little enhancement of GSH content was evident (data not shown). Moreover, we consistently found that the lower concentration (1 μM) of ACS1 and ACS67 enhanced GSH content to a greater extent than the higher concentration (10 μM). This observation was surprising, and we have no explanation for it, especially since H2S, as a sulfhydryl compound, has reducing properties similar to those of GSH. 42  
We therefore conclude that ACS67 and ACS1 attenuate, at least partially, the process of oxidative-induced RGC-5 cell death by the release of H2S, causing an elevation of GSH. Although there is impressive evidence to show that raising intracellular GSH can influence oxidative stress and consequently counteract apoptosis, 42,6365 it cannot be concluded from these studies that the neuroprotective effects of ACS67 and ACS1 are solely the result of their action on GSH. The actual process by which ACS67 and ACS1 act as neuroprotectants probably involves several mechanisms that are affected by H2S and not solely by a stimulation of GSH. Other mechanisms by which H2S has been shown to have a distinctive action includes the activation of ATP-dependent K+ (KATP) and Cl channels, postulated to be caused indirectly by oxidative stress on immortalized hippocampal cells. 9,19 It has also been observed that H2S protects astrocytes from injury caused by H2O2 by promoting glutamate uptake and in the process decreasing ROS generation, enhancing ATP production, and suppressing ERK1/2 activation. 22 Moreover, H2S stimulates adenylate cyclase and in the process modulates intracellular mechanisms 42 that could attenuate defined death mechanisms in neurons. 
Our studies clearly show that latanoprost does not counteract H2O2-induced loss of RGC-5 cell viability in culture. This observation provides support for the notion that the neuroprotective characteristics of ACS67 are associated with the release of H2S from the sulfurated moiety of latanoprost rather than with latanoprost itself. However, three publications have appeared that show latanoprost has neuroprotective properties. In the first study, latanoprost was shown to protect retinal cells in situ (ischemia) and in vitro (glutamate toxicity) by influencing cyclo-oxygenase and nitric oxide synthase activity. 66 The second study reported that ganglion cell death induced by axotomy or injection of NMDA into the vitreous humor are blunted by administration of latanoprost. 67 In the third study, latanoprost was reported to attenuate glutamate/BSO death to RGC-5 cells. 68 These authors also demonstrated that topical application of latanoprost attenuates retinal ganglion cell death in situ initiated by optic nerve crush. 68 We have no obvious explanation for finding no evidence to suggest that latanoprost acted as a neuroprotectant when RGC-5 cells are insulted by oxidative stress caused by H2O2 (Fig. 11). One possibility is that latanoprost may in some way be rendered inactive in the presence of H2O2
The conclusion reached from our study is that ACS67 is likely to be rapidly hydrolyzed in situ or in vitro to release H2S, which has neuroprotective properties and results in an attenuation of the negative effects of retinal ischemia or an oxidative insult to RGC-5 cells in culture. 
Footnotes
 Disclosure: N.N. Osborne, None; D. Ji, None; A.S.A. Majid, None; R.J. Fawcett, None; A. Sparatore, P; P. Del Soldato, CTG Pharma (I), P
References
Stjernschantz J Ocklind A Wentzel P Lake S Hu DN . Latanoprost-induced increase of tyrosinase transcription in iridial melanocytes. Acta Ophthalmol Scand. 2000; 78: 618–622. [CrossRef] [PubMed]
Perrino E Uliva C Lanzi C Soldato PD Masini E Sparatore A . New prostaglandin derivative for glaucoma treatment. Bioorganic Med Chem Lett. 2009; 19: 1639–1642. [CrossRef]
Li L Rossoni G Sparatore A Lee LC Del Soldato P Moore PK . Anti-inflammatory and gastrointestinal effects of a novel diclofenac derivative. Free Radic Biol Med. 2007; 42: 706–719. [CrossRef] [PubMed]
Szabü C . Hydrogen sulphide and its therapeutic potential. Nat Rev Drug Discov. 2007; 6: 917–935. [CrossRef] [PubMed]
Lefer DJ . A new gaseous signaling molecule emerges: cardioprotective role of hydrogen sulphide. Proc Natl Acad Sci. 2007; 104: 17907–17908. [CrossRef] [PubMed]
Moore PK Bhatia M Moochhala S . Hydrogen sulfide: from the smell of the past to the mediator of the future? Trends Pharmacol Sci. 2003; 24: 609–611. [CrossRef] [PubMed]
Kimura H Nagai Y Umenura K Kimura Y . Physiological roles of hydrogen sulfide: synaptic modulation, neuroprotection, and smooth muscle relaxation. Antioxid Redox Signal. 2005; 7: 795–803. [CrossRef] [PubMed]
Zhang H Bhatia M . Hydrogen sulfide: a novel mediator of leukocyte activation. Immunopharmacol Immunotoxicol. 2008; 30: 631–645. [CrossRef] [PubMed]
Kimura Y Kimura H . Hydrogen sulfide protects neurons from oxidative stress. FASEB J. 2004; 18: 1165–1167. [PubMed]
Abe K Kimura H . The possible role of hydrogen sulfide as an endogenous neuromodulator. J Neurosci. 1996; 16: 1066–1071. [PubMed]
Olson KR . Is hydrogen sulfide a circulating “gasotransmitter” in vertebrate blood? Biochim Biophys Acta. 2009; 1787(7): 856–863. [CrossRef] [PubMed]
Kimura H . Hydrogen sulphide induces cyclic AMP and modulates the NMDA receptor. Biochem Biophys Res Commun. 2000; 267: 129–133. [CrossRef] [PubMed]
Boehning D Snyder SH . Novel neural modulators. Annu Rev Neurosci. 2003; 26: 105–131. [CrossRef] [PubMed]
Kombian SB Reiffenstein RJ Colmers WF . The actions of hydrogen sulfide on dorsal raphe serotonergic neurons in vitro. J Neurophysiol. 1993; 70: 81–96. [PubMed]
Dello Russo C Tringali G Ragazzoni E . Evidence that hydrogen sulphide can modulate hypothalamo-pituitary-adrenal axis function: in vitro and in vivo studies in the rat. J Neuroendocrinol. 2000; 12: 225–233. [CrossRef] [PubMed]
Nagai Y Tsugane M Oka J Kimura H . Hydrogen sulfide induces calcium waves in astrocytes. FASEB J. 2004; 18: 557–559. [PubMed]
Doeller JE Isbell TS Benavides G . Polarographic measurement of hydrogen sulfide production and consumption by mammalian tissues. Anal Biochem. 2005; 341: 40–51. [CrossRef] [PubMed]
Elrod JW Calvert JW Morrison J . Hydrogen sulfide attenuates myocardial ischemia-reperfusion injury by preservation of mitochondrial function. Proc Natl Acad Sci. 2007; 104: 15560–15565. [CrossRef] [PubMed]
Kimura Y Dargusch R Schubert D Kimura K . Hydrogen sulphide protects HT22 neuronal cells from oxidative stress. Antioxid Redox Signal. 2006; 8: 661–670. [CrossRef] [PubMed]
Sivarajah A McDonald MC Thiemermann C . The production of hydrogen sulfide limits myocardial ischemia and reperfusion injury and contributes to the cardioprotective effects of preconditioning with endotoxin, but not ischemia in the rat. Shock. 2006; 26: 154–161. [CrossRef] [PubMed]
Umemura K Kimura H . Hydrogen sulfide enhances reducing activity in neurons: neurotrophic role of H2S in the brain? Antioxid Redox Signal. 2007; 9: 2035–2041. [CrossRef] [PubMed]
Lu M Hu LF Hu G Bian JS . Hydrogen sulfide protects astrocytes against H(2)O(2)-induced neural injury via enhancing glutamate uptake. Free Radic Biol Med. 2008; 45: 1705–1713. [CrossRef] [PubMed]
Tang XQ Yang CT Chen J . Effect of hydrogen sulphide on beta-amyloid-induced damage in PC12 cells. Clin Exp Pharmacol Physiol. 2008; 35: 180–186. [PubMed]
Jha S Calvert JW Duranski MR Ramachandran A Lefer DJ . Hydrogen sulfide attenuates hepatic ischemia-reperfusion injury: role of antioxidant and antiapoptotic signaling. Am J Physiol Heart Circ Physiol. 2008; 295: H801–H806. [CrossRef] [PubMed]
Bliksøen M Kaljusto ML Vaage J Stensløkken KO . Effects of hydrogen sulphide on ischaemia-reperfusion injury and ischaemic preconditioning in the isolated, perfused rat heart. Eur J Cardiothorac Surg. 2008; 34: 344–349. [CrossRef] [PubMed]
Cheung NS Peng ZF Chen MJ Moore PK Whiteman M . Hydrogen sulfide induced neuronal death occurs via glutamate receptor and is associated with calpain activation and lysosomal rupture in mouse primary cortical neurons. Neuropharmacology. 2007; 53: 505–514. [CrossRef] [PubMed]
Qu K Chen CP Halliwell B Moore PK Wong PT . Hydrogen sulfide is a mediator of cerebral ischemic damage. Stroke. 2006; 37: 889–893. [CrossRef] [PubMed]
Rossoni G Sparatore A Tazzari V Manfredi B Del Soldato P Berti F . The hydrogen sulphide-releasing derivative of diclofenac protects against ischaemia- reperfusion injury in the isolated rabbit heart. Br J Pharmacol. 2008; 153: 100–109. [CrossRef] [PubMed]
Sidhapuriwala J Li L Sparatore A Bhatia M Moore PK . Effect of S-diclofenac, a novel hydrogen sulfide releasing derivative, on carrageenan-induced hindpaw oedema formation in the rat. Eur J Pharmacol. 2007; 569: 149–154. [CrossRef] [PubMed]
Muzaffar S Jeremy JY Sparatore A Del Soldato P Angelini GD Shukla N . H2S-donating sildenafil (ACS6) inhibits superoxide formation and gp91phox expression in arterial endothelial cells: role of protein kinases A and G. Br J Pharmacol. 2008; 155: 984–994. [CrossRef] [PubMed]
Sparatore A Perrino E Tazzari V . Pharmacological profile of a novel H(2)S-releasing aspirin. Free Radic Biol Med. 2009; 46: 586–592. [CrossRef] [PubMed]
Osborne NN Larsen AK . Antigens associated with specific retinal cells are affected by ischaemia caused by raised intraocular pressure: effect of glutamate antagonists. Neurochem Int. 1996; 29: 263–270. [CrossRef] [PubMed]
Nash MS Osborne NN . Assessment of Thy-1 mRNA levels as an index of retinal ganglion cell damage. Invest Ophthalmol Vis Sci. 1999; 40: 1293–1298. [PubMed]
Chidlow G Casson R Sobrado-Calvo P Vidal-Sanz M Osborne NN . Measurement of retinal injury in the rat after optic nerve transection: an RT-PCR Study. Mol Vis. 2005; 11: 387–396. [PubMed]
Laemmli. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970; 227: 680–685. [CrossRef] [PubMed]
Ahmed SA Gogal RMJr Walsh JE . A new rapid and simple non-radioactive assay to monitor and determine the proliferation of lymphocytes: an alternative to [3H]thymidine incorporation assay. J Immunol Methods. 1994; 170: 211–224. [CrossRef] [PubMed]
Fields RD Lancaster MV . Dual-attribute continuous monitoring of cell proliferation/cytotoxicity. Am Biotechnol Lab. 1993; 1: 48–50.
Carter WO Narayanan PK Robinson JP . Intracellular hydrogen peroxide and superoxide anion detection in endothelial cells. J Leukoc Biol. 1994; 55: 253–258. [PubMed]
Cook JA Mitchell JB . Measurement of thiols in cell populations from tumor and normal tissue. Methods Enzymol. 1995; 251: 203–212. [PubMed]
Zhang B Safa R Rusciano D Osborne NN . Epigallocatechin gallate, an active ingredient from green tea, attenuates damaging influences to the retina caused by ischemia-reperfusion. Brain Res. 2007; 23: 40–53. [CrossRef]
Li GY Osborne NN . Oxidative-induced apoptosis to an immortalized ganglion cell line is caspase independent but involves the activation of poly(ADP- ribose)polymerase and apoptosis-inducing factor. Brain Res. 2008; 1188: 35–43. [CrossRef] [PubMed]
Qu K Lee SW Bian JS Low CM Wong PT . Hydrogen sulfide: neurochemistry and neurobiology. Neurochem Int. 2008; 52: 155–165. [CrossRef] [PubMed]
Block F Schwarz M . The b-wave of the electroretinogram as an index of retinal ischemia. Gen Pharmacol. 1998; 30: 281–287. [CrossRef] [PubMed]
Osborne NN Casson RJ Wood JP Chidlow G Graham M Melena J . Retinal ischemia: mechanisms of damage and potential therapeutic strategies. Prog Retin Eye Res. 2004; 23: 91–147. [CrossRef] [PubMed]
Casson RJ Wood JP Osborne NN . Hypoglycaemia exacerbates ischaemic retinal injury in rats. Br J Ophthalmol. 2004; 88: 816–820. [CrossRef] [PubMed]
Ji D Li GY Osborne NN . Nicotinamide attenuates retinal ischemia and light insults to neurones. Neurochem Int. 2008; 52: 786–798. [CrossRef] [PubMed]
Zhang B Rusciano D Osborne NN . Orally administered epigallocatechin gallate attenuates retinal neuronal death in vivo and light-induced apoptosis in vitro. Brain Res. 2008; 10: 141–152. [CrossRef]
Bringmann A Pannicke T Grosche J . Müller cells in the healthy and diseased retina. Prog Retin Eye Res. 2006; 25: 397–424. [CrossRef] [PubMed]
Nishiyama T Nishukawa S Hiroshi Tomita Tamai M . Müller cells in the preconditioned retinal ischemic injury rat. Tohoku J Exp Med. 2000; 191: 221–232. [CrossRef] [PubMed]
Barnett NL Osborne NN . Prolonged bilateral carotid artery occlusion induces electrophysiological and immunohistochemical changes to the rat retina without causing histological damage. Exp Eye Res. 1995; 61: 83–90. [CrossRef] [PubMed]
Katai N Yoshimura N . Apoptotic retinal neuronal death by ischemia-reperfusion is executed by two distinct caspase family proteases. Invest Ophthalmol Vis Sci. 1999; 40: 2697–2705. [PubMed]
Grütter MG . Caspases: key players in programmed cell death. Curr Opin Struct Biol. 2000; 10: 649–655. [CrossRef] [PubMed]
Dawson VL Dawson TM . Deadly conversations: nuclear-mitochondrial cross-talk. J Bioenerg Biomembr. 2004; 36: 287–294. [CrossRef] [PubMed]
Hong SJ Dawson TM Dawson VL . Nuclear and mitochondrial conversations in cell death: PARP-1 and AIF signaling. Trends Pharmacol Sci. 2004; 25: 259–264. [CrossRef] [PubMed]
Kroemer G Reed JC . Mitochondrial control of cell death. Nat Med. 2000; 6: 513–519. [CrossRef] [PubMed]
Krishnamoorthy RR Agarwal P Prasanna G . Characterization of a transformed rat retinal ganglion cell line. Brain Res Mol Brain Res. 2001; 86: 1–12. [CrossRef] [PubMed]
Osborne NN Li G-Y Ji D Mortiboys HJ Jackson S . Light affects mitochondria to cause apoptosis to cultured cells: possible relevance to ganglion cell death in certain optic neuropathies. J Neurochem. 2008; 105: 2013–2028. [CrossRef] [PubMed]
Mandel SA Avramovich-Tirosh Y Reznichenko L . Multifunctional activities of green tea catechins in neuroprotection. Modulation of cell survival genes, iron-dependent oxidative stress and PKC signaling pathway. Neurosignals. 2005; 14: 46–60. [CrossRef] [PubMed]
Wang CT Chang HH Hsiao CH . The effects of green tea (–)-epigallocatechin-3-gallate on reactive oxygen species in 3T3–L1 preadipocytes and adipocytes depend on the glutathione and 67 kDa laminin receptor pathways. Mol Nutr Food Res. 2009; 53: 349–360. [CrossRef] [PubMed]
Siram N Kalayasaran S Sudhandrian G . Enhancement of antioxidant defense system by epigallocatechin-3-gallate during bleomycin induced experimental pulmonary fibrosis. Biol Pharm Bull. 2008; 31: 1306–1311. [CrossRef] [PubMed]
Yin ST Tang ML Su L . Effects of epigallocatechin-3-gallate on lead-induced oxidative damage. Toxicology. 2008; 249: 45–54. [CrossRef] [PubMed]
Fu Y Zheng S Lu SC Chen A . Epigallocatechin-3-gallate inhibits growth of activated hepatic stellate cells by enhancing the capacity of glutathione synthesis. Mol Pharmacol. 2008; 73: 1465–1473. [CrossRef] [PubMed]
Ben-Yoseph O Boxer PA Ross BD . Assessment of the role of the glutathione and pentose phosphate pathways in the protection of primary cerebrocortical cultures from oxidative stress. J Neurochem. 1996; 66: 2329–2337. [CrossRef] [PubMed]
Atkuri KR Mantovani JJ Herzenberg LA Herzenberg LA . N-Acetylcysteine: a safe antidote for cysteine/glutathione deficiency. Curr Opin Pharmacol. 2007; 7: 355–359. [CrossRef] [PubMed]
Roh YJ Moon C Kim SY . Glutathione depletion induces differential apoptosis in cells of mouse retina, in vivo. Neurosci Lett. 2007; 7: 266–270. [CrossRef]
Drago F Valzelli S Emmi I Marino A Scalia CC Marino V . Latanoprost exerts neuroprotective activity in vitro and in vivo. Exp Eye Res. 2001; 72: 479–486. [CrossRef] [PubMed]
Kudo H Nakazawa T Shimura M . Neuroprotective effect of latanoprost on rat retinal ganglion cells. Graefes Arch Clin Exp Ophthalmol. 2006; 244: 1003–1009. [CrossRef] [PubMed]
Kanamori A Naka M Fukuda M Nakamura M Negi A . Latanoprost protects rat retinal ganglion cells from apoptosis in vitro and in vivo. Exp Eye Res. 2009; 88: 535–541. [CrossRef] [PubMed]
Figure 1.
 
A comparison of the structural differences between latanoprost, ACS1, and ACS67. ACS67 is a dithiolethione (ACS1) hybrid together with latanoprost. The dithiolethione molecule generates H2S once in a cell.
Figure 1.
 
A comparison of the structural differences between latanoprost, ACS1, and ACS67. ACS67 is a dithiolethione (ACS1) hybrid together with latanoprost. The dithiolethione molecule generates H2S once in a cell.
Figure 2.
 
In these studies, ERGs from both eyes were recorded. One eye was subsequently given ischemia. Five days later, the ERGs from the ischemic and nonischemic eyes were recorded and the percentage changes in the a- and b-wave amplitudes were compared between the ischemic and control eyes. Both the a- and b-wave amplitudes of the ERG were clearly reduced by ischemia-reperfusion (***P < 0.001 compared with control). Moreover, compared with vehicle, ACS67 significantly attenuated the reduction of the a- and b-wave amplitudes (**P < 0.01 compared with ischemia). Results are the mean ± SEM, n = 14.
Figure 2.
 
In these studies, ERGs from both eyes were recorded. One eye was subsequently given ischemia. Five days later, the ERGs from the ischemic and nonischemic eyes were recorded and the percentage changes in the a- and b-wave amplitudes were compared between the ischemic and control eyes. Both the a- and b-wave amplitudes of the ERG were clearly reduced by ischemia-reperfusion (***P < 0.001 compared with control). Moreover, compared with vehicle, ACS67 significantly attenuated the reduction of the a- and b-wave amplitudes (**P < 0.01 compared with ischemia). Results are the mean ± SEM, n = 14.
Figure 3.
 
NF-L (A), GFAP (B), and PARP (C) proteins relative to actin in the nonischemic retina (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant change in the amounts of NF-L, GFAP, and PARP proteins compared with the control (***P < 0.001). However, treatment with ACS67 significantly (**P < 0.01) blunted this effect. ACS67 reduced the change in NF-L, GFAP, and PARP proteins caused by ischemia by 14%, 24%, and 28%, respectively. Data are expressed as the mean; error bar, ± SEM (n = 12).
Figure 3.
 
NF-L (A), GFAP (B), and PARP (C) proteins relative to actin in the nonischemic retina (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant change in the amounts of NF-L, GFAP, and PARP proteins compared with the control (***P < 0.001). However, treatment with ACS67 significantly (**P < 0.01) blunted this effect. ACS67 reduced the change in NF-L, GFAP, and PARP proteins caused by ischemia by 14%, 24%, and 28%, respectively. Data are expressed as the mean; error bar, ± SEM (n = 12).
Figure 4.
 
Tubulin (A) and NF-L (B) proteins relative to actin in the nonischemic optic nerves (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant (***P < 0.001) decrease in both NF-L and tubulin proteins. ACS67 treatment significantly (**P < 0.01) attenuated the reduction of tubulin and NF-L proteins by 21% and 33%, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12).
Figure 4.
 
Tubulin (A) and NF-L (B) proteins relative to actin in the nonischemic optic nerves (control) and after ischemia-reperfusion with vehicle or ACS67 treatment. Ischemia-reperfusion caused a significant (***P < 0.001) decrease in both NF-L and tubulin proteins. ACS67 treatment significantly (**P < 0.01) attenuated the reduction of tubulin and NF-L proteins by 21% and 33%, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12).
Figure 5.
 
NF-L and Thy-1 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused a significant decrease in the mRNA level in vehicle-treated animals. These changes were significantly blunted by treatment with ACS67 by 21% and 19% for NF-L and Thy-1, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01, ***P < 0.001).
Figure 5.
 
NF-L and Thy-1 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused a significant decrease in the mRNA level in vehicle-treated animals. These changes were significantly blunted by treatment with ACS67 by 21% and 19% for NF-L and Thy-1, respectively. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01, ***P < 0.001).
Figure 6.
 
Caspase 3 and -8 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals, but these changes were not significantly blunted by treatment with ACS67. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01).
Figure 6.
 
Caspase 3 and -8 mRNA levels relative to cyclophilin (cyclo) mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals, but these changes were not significantly blunted by treatment with ACS67. Data are expressed as the mean; error bar, ±SEM (n = 12 in each case; **P < 0.01).
Figure 7.
 
GFAP and PARP mRNA levels relative to cyclophilin mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals but these changes were only significantly blunted for GFAP (31%) by treatment with ACS67. Data are expressed as the mean. Error bars, ±SEM (n = 12 in each case, ***P < 0.001, *P < 0.05).
Figure 7.
 
GFAP and PARP mRNA levels relative to cyclophilin mRNA in nonischemic retina (control) and after ischemia-reperfusion with treatment of vehicle (ischemia) or ACS67 (ischemia+ACS67). Ischemia-reperfusion caused significant elevation of the mRNA level in vehicle-treated animals but these changes were only significantly blunted for GFAP (31%) by treatment with ACS67. Data are expressed as the mean. Error bars, ±SEM (n = 12 in each case, ***P < 0.001, *P < 0.05).
Figure 8.
 
A summary of the information obtained from the analysis of retinas from six rats in which ischemia was induced in one eye in each case followed by intravitreal injection of either vehicle or ACS67. Ischemia-reperfusion caused a clear change in the thickness of the Thy-1 immunoreactivity (B) in the inner plexiform layer (IPL), and almost a complete loss of the nNOS immunoreactive amacrine cells (E) and distinctive strong staining of GFAP (thick arrows, H) associated with retinal Müller cells. The effect of ischemia on the localization of retinal Thy-1, nNOS, and GFAP immunoreactivity were attenuated in animals treated with ACS67 (C, F, I). (A) The broad band of Thy-1 immunoreactivity in the IPL of a control retina. (D) The nNOS immunoreactive neurons (thin arrows) and three bands of immunoreactivity (1, 2, 3) in the IPL in control retina. GFAP in the control retina (G) and in the retinas given ischemia-reperfusion where the animals were treated with ACS67 (I) was sparsely associated with Müller cells (thin arrows) and more densely associated with the nerve fiber layer.
Figure 8.
 
A summary of the information obtained from the analysis of retinas from six rats in which ischemia was induced in one eye in each case followed by intravitreal injection of either vehicle or ACS67. Ischemia-reperfusion caused a clear change in the thickness of the Thy-1 immunoreactivity (B) in the inner plexiform layer (IPL), and almost a complete loss of the nNOS immunoreactive amacrine cells (E) and distinctive strong staining of GFAP (thick arrows, H) associated with retinal Müller cells. The effect of ischemia on the localization of retinal Thy-1, nNOS, and GFAP immunoreactivity were attenuated in animals treated with ACS67 (C, F, I). (A) The broad band of Thy-1 immunoreactivity in the IPL of a control retina. (D) The nNOS immunoreactive neurons (thin arrows) and three bands of immunoreactivity (1, 2, 3) in the IPL in control retina. GFAP in the control retina (G) and in the retinas given ischemia-reperfusion where the animals were treated with ACS67 (I) was sparsely associated with Müller cells (thin arrows) and more densely associated with the nerve fiber layer.
Figure 9.
 
The effect of different concentrations of ACS1 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 9.
 
The effect of different concentrations of ACS1 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 10.
 
The effect of different concentrations of ACS67 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 10.
 
The effect of different concentrations of ACS67 in the absence or in the presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).
Figure 11.
 
The effect of different concentrations of latanoprost in the absence or presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM; (n = 6; **P < 0.01, ***P < 0.001).
Figure 11.
 
The effect of different concentrations of latanoprost in the absence or presence of 200 μM H2O2 (after 24 hours) on the viability of RGC-5 cells in culture as measured by the RRA assay. Results are expressed as the mean; error bars, ±SEM; (n = 6; **P < 0.01, ***P < 0.001).
Figure 12.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Staining of cultures was by use of Hoechst, which reveals damaged DNA (arrows) as an indicator of apoptosis. Several cells stained for apoptosis after H2O2 treatment (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A).
Figure 12.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Staining of cultures was by use of Hoechst, which reveals damaged DNA (arrows) as an indicator of apoptosis. Several cells stained for apoptosis after H2O2 treatment (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A).
Figure 13.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Cultures were stained with an apoptosis-detection kit that revealed membrane phosphatidylserine (arrows) as an indicator for apoptosis. Some cells showed staining for apoptosis after H2O2 treatment, (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A). Quantitative data after the analysis of four separate cultures where apoptotic cells were counted in five randomly chosen fields in each case are also shown. **P < 0.01, ***P < 0.001.
Figure 13.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 cell apoptosis induced by exposure to 200 μM H2O2 for 24 hours (B). (A) A control culture. Cultures were stained with an apoptosis-detection kit that revealed membrane phosphatidylserine (arrows) as an indicator for apoptosis. Some cells showed staining for apoptosis after H2O2 treatment, (B) which was blunted more by ACS67 (D) than EGCG (C) when compared with untreated control cells (A). Quantitative data after the analysis of four separate cultures where apoptotic cells were counted in five randomly chosen fields in each case are also shown. **P < 0.01, ***P < 0.001.
Figure 14.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 generation of ROS induced by exposure to H2O2 (200 μM) for 24 hours (B). (A) A control untreated culture. The yellow staining of nuclei reflects the intracellular generation of ROS. A large number of cells showed intense staining for ROS (arrows) after H2O2 treatment (B), and this reaction was blunted partially and almost completely by EGCG (C) and ACS67 (D), respectively.
Figure 14.
 
Effect of 10 μM ACS67 (D) and 50 μM EGCG (C) on RGC-5 generation of ROS induced by exposure to H2O2 (200 μM) for 24 hours (B). (A) A control untreated culture. The yellow staining of nuclei reflects the intracellular generation of ROS. A large number of cells showed intense staining for ROS (arrows) after H2O2 treatment (B), and this reaction was blunted partially and almost completely by EGCG (C) and ACS67 (D), respectively.
Figure 15.
 
Relative amounts of GSH fluorescence in RGC-5 cultures after exposure to ACS1, ACS67, EGCG, and latanoprost (LATAN) after 8 hours when compared with untreated control cultures. Results are expressed as the mean; error bars, ±SEM (n = 4; ***P < 0.001).
Figure 15.
 
Relative amounts of GSH fluorescence in RGC-5 cultures after exposure to ACS1, ACS67, EGCG, and latanoprost (LATAN) after 8 hours when compared with untreated control cultures. Results are expressed as the mean; error bars, ±SEM (n = 4; ***P < 0.001).
Table 1.
 
Primer Sequences
Table 1.
 
Primer Sequences
Primers Sequences Annealing Temp (°C) Accession Number
Caspase-3 TACCCTGAAATGGGCTTGTGT 52 BC081854
GTTAACACGAGTGAGGATGTG
Caspase-8 ACTGGCTGCCCTCAAGTTCCTGTGC 60 AF279308
TCCCTCACCATTTCCTCTGGGCTGC
Cyclophilin TGGTCAACCCCACCGTGTTCTTCG 52 M19533
GTCCAGCATTTGCCATGGACAAGA
GFAP ATTCCGCGCCTCTCCCTGTCTC 55 U03700
GCTTCATCCGCCTCCTGTCTGT
NF-L ATGCTCAGATCTCCGTGGAGATG 52 AF031880
GCTTCGCAGCTCATTCTCCAGTT
PARP-1 CCTAAGGAGATTCGGTGAG 52 NM_013063
GGCAAGCACAGTGTCAAA
Thy-1 CGCTTTATCAAGGTCCTTACTC 52 X03150
GCGTTTTGAGATATTTGAAGGT
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×