May 2010
Volume 51, Issue 5
Free
Retina  |   May 2010
Apolipoprotein E Genotype Is Associated with Macular Pigment Optical Density
Author Affiliations & Notes
  • Edward Loane
    From the Macular Pigment Research Group, Department of Chemical and Life Sciences, Waterford Institute of Technology, Waterford, Ireland;
    Ophthalmology Department, Royal Victoria Eye and Ear Hospital, Dublin, Ireland;
  • Gareth J. McKay
    Centre for Vision and Vascular Sciences, Queen's University Belfast, Belfast, Northern Ireland, United Kingdom; and
  • John M. Nolan
    From the Macular Pigment Research Group, Department of Chemical and Life Sciences, Waterford Institute of Technology, Waterford, Ireland;
  • Stephen Beatty
    From the Macular Pigment Research Group, Department of Chemical and Life Sciences, Waterford Institute of Technology, Waterford, Ireland;
    Whitfield Clinic, Waterford, Ireland.
  • Corresponding author: Edward Loane, Macular Pigment Research Group, Department of Chemical and Life Sciences, Waterford Institute of Technology, Waterford, Ireland; edwardloane@yahoo.com
Investigative Ophthalmology & Visual Science May 2010, Vol.51, 2636-2643. doi:10.1167/iovs.09-4397
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Edward Loane, Gareth J. McKay, John M. Nolan, Stephen Beatty; Apolipoprotein E Genotype Is Associated with Macular Pigment Optical Density. Invest. Ophthalmol. Vis. Sci. 2010;51(5):2636-2643. doi: 10.1167/iovs.09-4397.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Age-related macular degeneration (AMD) is the most common cause of blindness in older people in developed countries, and risk factors for this condition may be classified as genetic and environmental. Apolipoprotein E is putatively involved in the transport of the macular pigment (MP) carotenoids lutein (L) and zeaxanthin (Z) in serum and may also influence retinal capture of these compounds. This study was designed to investigate the relationship between macular pigment optical density (MPOD) and ApoE genotype.

Methods.: This was a cross-sectional study of 302 healthy adult subjects. Dietary intake of L and Z was assessed by food frequency questionnaire, and MPOD was measured by customized heterochromatic flicker photometry. Serum L and Z were measured by HPLC. ApoE genotyping was performed by direct polymerase chain reaction amplification and DNA nucleotide sequencing from peripheral blood.

Results.: Genotype data were available on 300 of the 302 (99.3%) subjects. The mean (± SD) age of the subjects in this study was 47.89 ± 11.05 (range, 21–66) years. Subjects were classed into one of three ApoE genotype groups, as follows: group 1, ε2ε2 or ε2ε3; group 2, ε3ε3; group 3, ε2ε4 or ε3ε4 or ε4ε4. All three groups were statistically comparable in terms of age, sex, body mass index, cigarette smoking, and dietary and serum levels of L and Z. There was a statistically significant association between ApoE genotype and MPOD. Subjects who had at least one ε4 allele had a higher MPOD across the macula than subjects without this allele (group 1 MPOD area, 0.70 ± 0.40; group 2 MPOD area, 0.67 ± 0.42; group 3 MPOD area, 0.85 ± 0.46; one-way ANOVA, P = 0.014.

Conclusions.: These results suggest that ApoE genotype status is associated with MPOD. This association may explain, at least in part, the putative protective effect of the ε4 allele for AMD and is consistent with the view that apolipoprotein profile influences the transport and/or retinal capture of circulating L and/or Z.

Age-related macular degeneration (AMD) is the leading cause of blindness in people older than 50 years of age in the developed world and results in loss of central and color vision if not treated or if not amenable to treatment. 13 The prevalence of this condition is likely to increase dramatically in the future as a result of increasing life expectancy and the consequential increasing senescence of society. 4 The pathogenesis of AMD is incompletely understood, but it is believed to involve a complex interaction between multiple risk genes and environmental factors. 5,6  
Macular pigment (MP) is composed of the hydroxycarotenoids lutein (L), zeaxanthin (Z), and meso-zeaxanthin (meso-Z). L and Z are of dietary origin and are not synthesized de novo in humans, whereas meso-Z is not found in a conventional western diet but is understood to be formed primarily in the retina after conversion from L. 7,8 Interestingly, it has been shown that L is the dominant carotenoid in the diet, 9 whereas Z/meso-Z have been shown to be the dominant carotenoids at the central macula. 10,11 MP is found in highest concentration at the central macula, where it functions as a powerful antioxidant and acts as a filter of actinic short-wavelength blue light, thus limiting photo-oxidative damage to retinal cells. 12 These properties of MP are believed to be the mechanism whereby it may protect against the development and/or progression of AMD. 
Although MP is entirely of dietary origin, it is also subject to heritability, as reported in 2005 by Liew et al. 13 in a classic twin study. In that study of 76 monozygotic and 74 dizygotic female twin pairs, they measured MP using two different techniques, heterochromatic flicker photometry (HFP) and fundus autofluorescence. They then applied genetic modeling techniques to determine the relative contributions of genetic and environmental factors to the variation in MP levels, estimating that heritability accounted for between 67% and 85% of a subject's MP level. Taken together with the recent finding of a relative lack of MP in association with a family history of AMD, it would appear reasonable to hypothesize that genetic predisposition to this disease may be attributable, at least in part, to a parallel and relative lack of this pigment. 6  
ApoE gene status is believed to be a determinant of AMD risk. 1418 The ApoE gene has three separate alleles—Apo ε2, Apo ε3, and Apo ε4—which are differentiated on the basis of cysteine-arginine residue interchanges at positions 112 and 158 in the amino acid sequence. 19 As a result of this polymorphism, six common phenotypes exist: three homozygous phenotypes (ε3ε3, ε2ε2, ε4ε4) and three heterozygous phenotypes (ε2ε3, ε2ε4, ε3ε4). The ε4 allele has been found to be associated with a reduced risk for AMD, whereas the ε2 allele has been associated with an increased risk for this disease. 1418,20,21 The ApoE gene codes for apolipoproteins, which are major transporters of lipids and cholesterol in the nervous system. 22  
It is known that L and Z are transported in serum on circulating lipoproteins and are relatively equally distributed between low-density lipoprotein (LDL) and high-density lipoprotein (HDL) molecules. 2325 Because apolipoprotein E is an integral part of chylomicrons and other lipoproteins, including very low-density lipoprotein (VLDL) and HDL, 19,26 we hypothesized that there may be a relationship between the quantity of MP in the retina and the apolipoprotein E profile, coded for by ApoE genotype. Moreover, the recent finding of a relative lack of MP in association with a clinically confirmed family history of AMD and the observation that MP optical density (MPOD), though entirely of dietary origin, is subject to heritability, prompted us to explore the relationship between this putatively protective pigment and ApoE genotype. 6,13  
Subjects and Methods
Subjects
Three hundred two subjects were recruited for this study, which was carried out in the Macular Pigment Research Group laboratory at the Waterford Institute of Technology (Waterford, Ireland). Subjects were recruited after local advertisement in various media. This study was approved by the Research Ethics Committee of the Waterford Institute of Technology, and each subject was required to sign an informed consent document before participation. All experimental procedures adhered to the tenets of the Declaration of Helsinki. 
Inclusion criteria for participation in this study were age between 20 and 70 years, no clinical evidence of ocular pathology, no dietary supplementation with the MP carotenoids, and visual acuity of 20/40 or better. The following information was recorded for each subject: demographic details; family history of AMD (confirmed by letter from the diagnosing ophthalmologist); personal smoking history; and dietary intake of L and Z, assessed using a validated 170-item food frequency questionnaire (FFQ). Examination included visual acuity (Snellen and LogMAR); body mass index (BMI; calculated in kg/m2); MPOD measurement by customized heterochromatic flicker photometry (cHFP; using the macular densitometer); nonmydriatic fundus photography, using a nonmydriatic auto fundus camera (AFC-210; Nidek, Aichi, Japan) to screen for ocular pathology; and 12-hour fasting blood samples taken to quantify serum concentrations of L and Z using high-performance liquid chromatography (HPLC) and for genotyping. 
Food Frequency Questionnaire
Dietary intake of L and Z was assessed by a self-administered, semiquantitative FFQ developed by the Scottish Collaborative group (SCG; University of Aberdeen, Scotland, UK). This semiquantitative FFQ is the primary method used in epidemiologic studies to assess dietary intake of various nutrients and foods most commonly consumed in a Western diet. 27 This FFQ is a development of FFQs used in the Scottish Heart Health Study. It has been validated against weighed food records and biomarkers, and its validity, in terms of separately quantifying dietary intake of L and Z, has been confirmed in a study by O'Connell et al. 2830  
The questionnaire is designed to assess a subject's dietary intake over the preceding 2 to 3 months. Although subjects were assessed at different time points throughout the year, it has been shown that month-to-month serum concentrations of L and Z and MPOD are relatively stable over a 24-month period. 31 The FFQ consists of 170 foods and drinks, grouped into 21 sections. A standard portion or measure for each type of food or drink is specified, and subjects are required to indicate how many portions they consumed per day and how often they consumed each type of food, ranging in frequency from “rarely or never” to “7 days per week.” The questionnaire includes a color photograph depicting examples of standard food measures and an example of how to fill out the questionnaire. The questionnaire was completed by the subject in the presence of the primary investigator (EL) after detailed instructions for the required task. This questionnaire took between 20 and 30 minutes to complete. 
Completed FFQs were inputted into a spreadsheet (Access; Microsoft, Redmond, CA) developed for analysis purposes by the SCG. Nutrient analysis was performed with a program (Visual Basic for Microsoft Access; Microsoft) using food composition data based on McCance and Widdowson's The Composition of Foods. 32 Dietary intake of L and Z was calculated based on food composition data from United Kingdom, European, and United States data sources according to standard principles or criteria for the matching of food items and standardized recipes or manufacturers' ingredient information where necessary. 3336  
Measurement of Macular Pigment Optical Density
MPOD was measured psychophysically by cHFP, a technique that has been validated against the absorption spectrum of MP in vitro. 37 HFP is based on the fact that MP absorbs short-wavelength blue light, with peak absorption occurring at a wavelength of 458 nm. The subject is required to make isoluminance matches between two flickering lights, a green light (not absorbed by MP) and a blue light (maximally absorbed by MP). The log ratio of the amount of blue light absorbed centrally, where MP peaks, to that absorbed at a peripheral retinal locus (the reference point), where MPOD is assumed to be zero, gives a measure of the subject's MPOD. 
In this study, we used the macular densitometer, a cHFP instrument slightly modified from a device described by Wooten et al. 38 Each subject was required to observe a flickering target, alternating in square-wave counterphase between a green light with a wavelength of 564 nm and a blue light with a wavelength of 460 nm and to make isoluminance matches between these flickering lights. The luminance of the green and blue lights is varied in a yoked manner, which avoids a change in the overall luminance of the test target. When an isoluminant (null flicker) match has been made between these flickering lights, flicker is no longer perceived; this is the desired end point of the test. Differently sized targets enable measurements of MPOD at 0.25°, 0.5°, 1°, and 1.75° retinal eccentricity, compared with a reference point at 7° retinal eccentricity (where MPOD is assumed to equal 0). Targets are presented on a blue background test field (wavelength, 468 nm) that saturates the S-cone pathway. A minimum of three null-flicker readings were recorded for each subject at each of the test loci (0.25°, 0.5°, 1°, 1.75°, and 7° retinal eccentricity). Measurement of MPOD at these points of retinal eccentricity enabled us to plot the spatial profile of MP across the macula. For each subject, we then calculated the area of MPOD under the spatial profile, using the trapezoid rule, as follows: MPOD area = ({[(MPOD at 0.25° + MPOD at 0.5°)/2] × 0.25°} + {[(MPOD at 0.5° + MPOD at 1°)/2] × 0.5°} + {[(MPOD at 1° + MPOD at 1.75°)/2] × 0.75°} + {[(MPOD at 1.75° + MPOD at 7°)/2] × 5.25°}), assuming an MPOD of zero at 7° retinal eccentricity and also assuming a linear fit between each successive point of measurement of MPOD but a nonlinear MP spatial profile overall, as illustrated for subject 1 in Figure 1. This MPOD area gives a better measurement of the quantity of MP across the macula than an individual measurement at a single point of retinal eccentricity. MPOD measurement was performed under conditions of dimmed light (ambient illuminance 4 lux, as measured with a lux meter [ILM 350; Iso-Tech, Champaign, IL]) at a viewing distance of 18.5 inches (47 cm). 
Figure 1.
 
MPOD spatial profile for subject 1.
Figure 1.
 
MPOD spatial profile for subject 1.
The major advantage of cHFP over standard HFP instruments is that the flicker frequency of each test target is customized for each subject, minimizing the variance between consecutive measurements and, thus, increasing the accuracy and ease of use of the test. A more detailed description of this instrument has been published by Wooten et al. 38 Further information on the technique and advantages of cHFP have been published by Nolan et al. 39 and Loane et al. 40  
Blood Sample Collection
A 12-hour fasting blood sample was collected from each subject in a 4-mL tube (Z Serum Sep Clot Activator Vacuette; Greiner Bio-One GmbH, Kremsmünster, Austria) at the beginning of the study visit. This whole blood sample was immediately refrigerated at 2°C to 8°C, before centrifugation at approximately 1800g for 10 minutes. Centrifugation was performed within 4 hours of phlebotomy. After centrifugation, the supernatant serum sample was divided as aliquot portions into 1.5-mL amber light-sensitive microcentrifuge tubes (Brand GmbH, Wertheim, Germany) and stored at minus 70°C before analysis. 
Serum L and Z Analyses
Serum L and Z were quantified using reversed-phase HPLC. We used an Agilent system (1200 series LC; Agilent Technologies Ireland Ltd., Dublin, Ireland), with photodiode array detection at 295 nm, 325 nm, and 450 nm. A 5-μm analytical/preparative 4.6 × 250 mm 201TP specialty reversed-phase column (Vydac, Hesperia, CA) was used with an in-line guard column. The mobile phase consisted of 97% methanol and 3% tetrahydrofuran and was degassed using an in-line degasser. The flow rate was 1 mL/min, and the total run time was 15 minutes. All carotenoid peaks were integrated and quantified using corresponding software (Chem Station; Agilent). 
A 400-μL aliquot of serum was pipetted into a 1.5-mL clear microcentrifuge tube. Ethanol (300 μL) containing 25 μg/mL butylated hydroxytoluene and 200 μL internal standard containing 25 μg/mL α-tocopherol acetate was added to each tube. Heptane (500 μL) was then added, and samples were vortexed vigorously for 1 minute, followed by centrifugation at approximately 225g for 5 minutes. The resultant heptane layer was retained and transferred to a second, labeled 1.5-mL light-sensitive microcentrifuge tube, and another heptane extraction was performed. The combined heptane layers were immediately evaporated to dryness under a stream of nitrogen using a sample concentrator (Techne Sample Concentrator; Davison & Hardy Ltd., Belfast, Northern Ireland, UK). These dried samples were reconstituted in methanol (200 μL), and a 150-μL sample was injected for HPLC analysis. 
DSM Nutritional Products (Basel, Switzerland) provided the L and Z standards that were used to generate standard curves for quantification of these carotenoids. This assay was validated against the National Institute of Standards and Technology standard before analysis. 
ApoE Sequencing
DNA was extracted from peripheral blood leukocytes or frozen buffy coat samples using standard protocols. The ApoE subtypes are determined by the combination of alleles at the two nonsynonymous SNPs, rs429358 (C130R) and rs7412 (R176C), located within exon 4. Exon 4 was PCR amplified using sense (CCTCTGCCCCGTTCCTTCTC) and antisense (GGCCAGCAGATGCGTGAAAC) oligonucleotides under the following PCR conditions: 95°C for 60 seconds, followed by 35 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 60 seconds, followed by 72°C for 10 minutes. A sequencing kit (Big Dye Terminator v3.1 Cycle ABI Prism; Applied Biosystems, Foster City, CA) was used in conjunction with the ApoE antisense sequencing primer (TCCTGTAGCGGCTGGCCG) according to the manufacturer's instructions for processing on a genetic analyser (ABI 3100; Applied Biosystems). 
Statistical Analysis
A commercially available statistical software package (SPSS version 17; SPSS, Chicago, IL) was used for statistical analysis of results. A graphics software package (SigmaPlot version 8.0; Systat, San Jose, CA) was used for graphical presentation of results. One-way ANOVA was used to investigate differences in variables between the various genotype groups. Further associations were investigated using a general linear model approach, with Pearson chi-square testing and independent-samples t testing, as appropriate. The level of statistical significance was set at the standard P < 0.05. 
Results
Genotype data were available on 300 of the 302 (99.3%) subjects included in this study. We divided the study sample into three ApoE genotype groups (group 1, ε2ε2 or ε2ε3; group 2, ε3ε3; group 3, ε2ε4 or ε3ε4 or ε4ε4) for analysis purposes, as detailed in Table 1. This was done to increase the statistical power of our analysis because there were very few subjects with certain genotypes given the relatively low minor allele frequency (MAF) of rs429358 (MAF, 0.11) and rs7412 (MAF, 0.09) in Caucasian populations (one subject had the ε2ε2 genotype, two subjects had the ε2ε4 genotype, and six subjects had the ε4ε4 genotype). Interestingly, the subject with the ε2ε2 genotype had a clinically confirmed family history of AMD, and 5 of 6 (83.3%) subjects with the ε4ε4 genotype had a negative family history of AMD. 
Table 1.
 
ApoE Genotype Distribution for All Subjects
Table 1.
 
ApoE Genotype Distribution for All Subjects
ApoE Genotype Entire Group (n = 300) Negative Family History (n = 179) Positive Family History (n = 121)
Group 1 (ε2ε2, ε2ε3) 40 25 15
Group 2 (ε3ε3) 190 113 77
Group 3 (ε2ε4, ε3ε4, ε4ε4) 70 41 29
Anthropometric and lifestyle data of all subjects, divided according to ApoE genotype group, are detailed in Table 2. The mean (± SD) age of all subjects who underwent genotyping in this study was 47.89 ± 11.05 (range, 21–66) years. Seventy percent of the subjects included in this study were women. There was no statistically significant difference between each ApoE genotype group in terms of any of the following variables: age, BMI, cigarette smoking, dietary L intake, dietary Z intake, serum L concentration, serum Z concentration (one-way ANOVA, P > 0.05). There was also no statistically significant difference between the ApoE genotype groups in terms of the male/female ratio of subjects or between the ratio of subjects with a positive/negative family history of AMD in each of the ApoE genotype groups (Pearson chi-square P > 0.05, for both comparisons; Table 1). 
Table 2.
 
Anthropometric and Lifestyle Data for All Subjects According to ApoE Genotype Group
Table 2.
 
Anthropometric and Lifestyle Data for All Subjects According to ApoE Genotype Group
Characteristic Group 1 (n = 40) Group 2 (n = 190) Group 3 (n = 70)
Age, y 49.20 ± 10.80 48.37 ± 11.50 45.83 ± 9.76
Sex, n %
    Male 12 (30) 54 (28.4) 24 (34.3)
    Female 28 (70) 136 (71.6) 46 (65.7)
BMI* 26.29 ± 3.92 26.79 ± 4.71 26.64 ± 4.52
MPOD† 0.25° 0.50 ± 0.24 0.45 ± 0.20 0.56 ± 0.19
MPOD 0.5° 0.38 ± 0.17 0.36 ± 0.17 0.43 ± 0.18
MPOD 1° 0.24 ± 0.12 0.22 ± 0.12 0.29 ± 0.14
MPOD 1.75° 0.12 ± 0.09 0.12 ± 0.09 0.15 ± 0.11
MPOD area 0.70 ± 0.40 0.67 ± 0.42 0.85 ± 0.46
Smoking, pack-years‡ 5.33 ± 13.76 5.69 ± 10.35 5.82 ± 12.40
Dietary L, mg 1.376 ± 1.695 1.421 ± 1.113 1.234 ± 0.857
Dietary Z, mg 0.189 ± 0.150 0.189 ± 0.107 0.181 ± 0.091
Serum L, μg/mL 0.085 ± 0.047 0.089 ± 0.047 0.092 ± 0.049
Serum Z, μg/mL 0.016 ± 0.014 0.017 ± 0.017 0.017 ± 0.010
Positive family history of AMD, % 37.5 40.5 41.4
MPOD at 0.5° retinal eccentricity of all genotyped subjects was 0.38 ± 0.17 (range, 0–1.02 optical density units [ODU]). There was a statistically significant association between ApoE genotype and MPOD at all degrees of retinal eccentricity (one-way ANOVA, P ≤ 0.016), except at 1.75°, where it approached statistical significance (one-way ANOVA, P = 0.062); subjects who had at least one ε4 allele had higher MPOD than subjects without this allele. There was also a statistically significant association between MPOD area and ApoE genotype (one-way ANOVA, P = 0.014), as illustrated in Figure 2
Figure 2.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Figure 2.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
When we analyzed subjects with the ε4ε4 genotype as a separate group, we again found a statistically significant association between ApoE genotype and MPOD at all degrees of retinal eccentricity (one-way ANOVA, P ≤ 0.028), except at 1.75° (one-way ANOVA, P = 0.135); subjects who had the ε4ε4 genotype had significantly higher MPOD than other subjects, as detailed in Table 3. The statistically significant association between MPOD area and ApoE genotype (one-way ANOVA, P = 0.036) is illustrated in Figure 3
Table 3.
 
MPOD Values at Each Retinal Eccentricity According to ApoE Genotype, with the ε4ε4 Genotype Analyzed Separately
Table 3.
 
MPOD Values at Each Retinal Eccentricity According to ApoE Genotype, with the ε4ε4 Genotype Analyzed Separately
Characteristic Group 1 ε2ε2 or ε2ε3 (n = 39) Group 2 ε3ε3 (n = 187) Group 3 ε2ε4 or ε3ε4 (n = 63) Group 4 ε4ε4 (n = 6)
MPOD 0.25° 0.50 ± 0.24 0.45 ± 0.20 0.55 ± 0.19 0.62 ± 0.26
MPOD 0.5° 0.38 ± 0.17 0.36 ± 0.17 0.42 ± 0.18 0.49 ± 0.22
MPOD 1° 0.24 ± 0.12 0.22 ± 0.12 0.29 ± 0.14 0.26 ± 0.16
MPOD 1.75° 0.12 ± 0.09 0.12 ± 0.09 0.15 ± 0.11 0.15 ± 0.06
MPOD Area 0.70 ± 0.40 0.67 ± 0.42 0.85 ± 0.47 0.87 ± 0.37
Figure 3.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Figure 3.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Discussion
This study investigated the relationship between MPOD and ApoE genotype in 302 healthy subjects between 21 and 66 years of age. The mean MPOD of all genotyped subjects at 0.5° retinal eccentricity was 0.38 ± 0.17 ODU, which is comparable to that in previous studies that used HFP to measure MPOD at this eccentricity. 6,4145 Genotype data were available on 99.3% of our sample. 
It is widely accepted that the effect exerted by the ε3 allele is neutral for a number of diseases and that the effects exerted by either the ε2 or the ε4 allele are either risky or protective, depending on the disease in question. 4648 In the case of ApoE and AMD, most studies, but particularly the more robust meta-analyses, have suggested that the ε4 allele acts in a dominant manner and that it has a protective effect regardless of the presence of one or two alleles. 48 Therefore, although it would have been preferable to compare samples of equal sizes, this was not possible because of the low in vivo haplotype frequencies of the ε2 and ε4 alleles in the population under investigation. As a result, we elected to divide the study sample into three genotype groups for purposes of analysis. 
We found that there was a statistically significant association between MPOD and ApoE genotype. Subjects who carried the ε4 allele had a higher MPOD than did noncarriers; the mean difference in the MPOD area between the ε4 allele group (group 3) and the other two groups was 0.18 ODU. This difference could not be attributed to differences in dietary intake or differences in serum concentrations of the macular carotenoids among the three groups. Importantly, the three analysis groups were also comparable to one another with respect to age, sex, BMI, and cigarette smoking, factors that may influence MPOD. 6 We did not observe a relative lack of MPOD in association with the ε2 allele, which is putatively, but unconvincingly, linked to an increased risk for AMD compared with the ε3 allele. However, in the three meta-analyses investigating the association between ApoE and AMD, an increased odds ratio between 1.11 and 1.33 was observed in association with the ε2 allele; this finding was nonstatistically significant in one of these meta-analyses and barely significant in the other two. 4850  
MP carotenoids are derived entirely from diet, but macular levels of these carotenoids are subject to influence by genetic background, as shown in the classic twin study by Liew et al. 13 There is a large body of evidence to suggest that MP may protect against the development and/or progression of AMD. 51 This putative protective effect is based on the known properties of MP as a prereceptoral filter of actinic short-wavelength blue light and its antioxidant capacity, including the ability to quench singlet oxygen 52 and to inhibit the peroxidation of membranous phospholipids. 53 It has been estimated that MP absorbs approximately 40% of damaging short-wavelength irradiation before its incidence on the photoreceptors and the retinal pigment epithelium (RPE). 54 This is deemed to be particularly important because it has been shown by Ham et al. 55 that exposure to short-wavelength blue light can result in photochemical retinal injury in primates. In their study, they exposed rhesus monkey retinas to blue light for 1000 seconds, which resulted in atrophic AMD-like lesions and damage to the photoreceptor outer segments, cellular proliferation, and hypopigmentation of the RPE. They found that the threshold for such retinal damage was lowest for blue light than for other wavelengths of visible light. 55 In addition, it has been shown that the administration of antioxidants can prevent light-induced retinal damage in rat retinas. 56 In other words, there is a substantial body of evidence that cumulative exposure to short wavelength blue light is involved in the pathogenesis of AMD and that this mechanism of retinal injury can be prevented by the administration of antioxidants. 
Beyond the contribution of MP to limiting blue light–induced photo-oxidative damage and the consequential generation of reactive oxygen intermediates (ROIs), its constituent carotenoids are also known to quench existing ROIs in the retina as reported by Khachik et al., 57 who demonstrated the presence of direct oxidation products of L and Z in the retina. Indeed, oxidatively damaged photoreceptors cannot be completely digested by the apposing RPE, thus contributing to the accumulation of lipofuscin in this apposing cell layer. 58 Importantly, lipofuscin is a chromophore, rendering the blue light–filtering properties of MP all the more important. 59,60 Indeed, it has been hypothesized that the relative lack of lipofuscin in foveal RPE cells, when compared with surrounding RPE cells, is the result of protection conferred by MP against oxidation of the overlying photoreceptors and a consequential reduction in lipofuscin production at this location. 61,62  
The absorption of the MP carotenoids, L and Z, from the gastrointestinal tract involves incorporation into micelles, 23 most likely followed by a facilitated, protein-mediated transport mechanism across human enterocytes. 63 Once absorbed into the bloodstream, L and Z are associated with plasma lipoproteins, being relatively equally distributed between LDL and HDL, 2325 with a progressive decrease in the content of L and Z from light to dense LDL. However, some studies have reported that HDL is the preferential carrier of the MP carotenoids in plasma. 6466 The uptake of these carotenoids into the retina is less well understood. Bernstein et al. 67 and Bhosale et al. 68 have identified specific xanthophyll-binding proteins, of which the Pi isoform of glutathione S-transferase has a high affinity for Z and meso-Z, but not for L. In a recent publication, Bhosale et al. 68 have also identified a human retinal L-binding protein purified from peripheral human retina. 69 Connor et al. 65 have shown in a study of Wisconsin hypo-alpha mutant chicks, which have a genetic mutation resulting in very low circulating HDL levels, that retinal L accumulation was only 6% that of control chicks, suggesting an important role for HDL in the transport of L in serum, its capture by the retina, or both. 
The ApoE gene codes for apolipoproteins, which are the protein constituents of lipoproteins, particularly plasma chylomicrons, VLDL, and a subclass of HDL. Apolipoprotein E is essential for cholesterol transport and metabolism and for receptor-mediated uptake of specific lipoproteins. 70 It is an important regulator of cholesterol metabolism because of its affinity for apolipoprotein E-specific receptors in the liver and its affinity for LDL receptors in the liver and other peripheral tissues requiring cholesterol. 70 Apolipoprotein E is polymorphic and three common isoforms—E2, E3, and E4—which are coded for by three separate alleles, Apo ε2, Apo ε3, and Apo ε4. These alleles are differentiated on the basis of cysteine-arginine residue interchanges at positions 112 and 158 in the amino acid sequence. 19 As a result of this polymorphism, six common phenotypes exist—three homozygous phenotypes (ε3ε3, ε2ε2, ε4ε4) and three heterozygous phenotypes (ε2ε3, ε2ε4, ε3ε4). ApoE polymorphisms result in differences in the metabolism of apolipoprotein E-containing lipoprotein particles. 71  
In the retina, apolipoprotein E is synthesized in Müller cells and in the RPE, and apolipoprotein E has been identified in drusen. 7274 Klaver et al. 15 suggested that a high degree of apolipoprotein E biosynthesis is required to support the high rate of photoreceptor renewal in the macular region. Indeed, clinical manifestations of retinal degeneration are exhibited in ApoE-deficient mice that carry an ApoE gene inactivated by gene targeting. 75 However, the association of the ApoE gene with AMD in humans has been inconsistent, with some studies showing a protective effect for the ε4 allele and an increased risk in carriers of the ε2 allele, 1417,21,49 whereas others have shown no such association with the disease. 7682 In the three meta-analyses that have been reported on the association between ApoE profile and AMD, a decreased odds ratio associated with the ε4 allele, ranging from 0.6 to 0.67, was observed, and this association was highly significant in all three meta-analyses. 4850 Thus, the evidence to date favors a protective role for the Apo ε4 allele because several of the studies that did not show an overall association between the ApoE gene and AMD have reported a nonsignificant trend toward a protective effect for this allele. 
Selective binding of certain receptors to HDL particles enriched with apolipoprotein E has been demonstrated within the CNS. 83 These receptors include the LDL receptor and the LDL receptor-related protein. It has also been shown that there is a lack of binding of such receptors to HDL particles deficient in apolipoprotein E. This selectivity of the uptake mechanism may be dependent on the specific apolipoprotein E that forms part of the transporting lipoprotein molecule. This, in turn, could affect the ability of retinal receptors to bind with, and incorporate, such molecules, thus affecting the uptake of any other substances transported by these lipoproteins. Because Connor et al. 65 have demonstrated that retinal uptake of L is facilitated by an HDL-mediated transport system, it is reasonable to suggest that apolipoprotein E polymorphism may impact the method of capture of L by the retina. Certainly, our observation that the Apo ε4 allele is associated with a relative surplus of MP, but in a way that is unrelated to dietary intake or serum levels of its constituents, supports this view and represents a possible explanation for the putative protective role that the Apo ε4 allele plays in the pathogenesis of AMD. 
In conclusion, we have shown that there is a statistically significant and positive association between MPOD and presence of at least one Apo ε4 allele in a cohort of 300 healthy subjects. This observation may relate to the role that apolipoprotein E4, coded for by the Apo ε4 allele, plays in the lipoprotein-mediated transport of L and Z in serum and the subsequent uptake of these carotenoids by the retina. 
Footnotes
 Supported by a European Union Strand 1 research grant and by a Bausch & Lomb Ireland research grant.
Footnotes
 Disclosure: E. Loane: None; G.J. McKay: None; J.M. Nolan, NutraSight Consultancy Limited (C); S. Beatty, NutraSight Consultancy Limited (C)
References
Bressler NM . Age-related macular degeneration is the leading cause of blindness. JAMA. 2004;291(15):1900–1901. [CrossRef] [PubMed]
Congdon NG Friedman DS Lietman T . Important causes of visual impairment in the world today. JAMA. 2003;290(15):2057–2060. [CrossRef] [PubMed]
Klein R Wang Q Klein BEK Moss SE Meuer SM . The relationship of age-related maculopathy, cataract, and glaucoma to visual acuity. Invest Ophthalmol Vis Sci. 1995;36(1):182–191. [PubMed]
van Leeuwen R Klaver CC Vingerling JR Hofman A de Jong PT . Epidemiology of age-related maculopathy: a review. Eur J Epidemiol. 2003;18(9):845–854. [CrossRef] [PubMed]
Tomany SC Wang HJ van Leeuwen R . Risk factors for incident age-related macular degeneration: pooled findings from 3 continents. Ophthalmology. 2004;111(7):1280–1287. [CrossRef] [PubMed]
Nolan JM Stack J O'Donovan O Loane E Beatty S . Risk factors for age-related maculopathy are associated with a relative lack of macular pigment. Exp Eye Res. 2007;84(1):61–74. [CrossRef] [PubMed]
Bone RA Landrum JT Hime GW Cains A Zamor J . Stereochemistry of the human macular carotenoids. Invest Ophthalmol Vis Sci. 1993;34(6):2033–2040. [PubMed]
Johnson EJ Neuringer M Russell RM Schalch W Snodderly DM . Nutritional manipulation of primate retinas, III: effects of lutein or zeaxanthin supplementation on adipose tissue and retina of xanthophyll-free monkeys. Invest Ophthalmol Vis Sci. 2005;46(2):692–702. [CrossRef] [PubMed]
Bialostosky K Wright JD Kennedy-Stephenson J McDowell M Johnson CL . Dietary intake of macronutrients, micronutrients, and other dietary constituents: United States 1988–94. Vital Health Stat. 2002;(245):1–158.
Bone RA Landrum JT Fernandez L Tarsis SL . Analysis of the macular pigment by HPLC: retinal distribution and age study. Invest Ophthalmol Vis Sci. 1988;29(6):843–849. [PubMed]
Snodderly DM Handelman GJ Adler AJ . Distribution of individual macular pigment carotenoids in central retina of macaque and squirrel monkeys. Invest Ophthalmol Vis Sci. 1991;32(2):268–279. [PubMed]
Snodderly DM . Evidence for protection against age-related macular degeneration by carotenoids and antioxidant vitamins. Am J Clin Nutr. 1995;62(6):S1448–S1461.
Liew SHM Gilbert C Spector TD . Heritability of macular pigment: a twin study. Invest Ophthalmol Vis Sci. 2005;46(12):4430–4436. [CrossRef] [PubMed]
Baird PN Guida E Chu DT Vu HTV Guymer RH . The ε2 and ε4 alleles of the apolipoprotein gene are associated with age-related macular degeneration. Invest Ophthalmol Vis Sci. 2004;45(5):1311–1315. [CrossRef] [PubMed]
Klaver CC Kliffen M van Duijn CM . Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet. 1998;63(1):200–206. [CrossRef] [PubMed]
Simonelli F Margaglione M Testa F . Apolipoprotein E polymorphisms in age-related macular degeneration in an Italian population. Ophthalmic Res. 2001;33(6):325–328. [CrossRef] [PubMed]
Souied EH Benlian P Amouyel P . The epsilon4 allele of the apolipoprotein E gene as a potential protective factor for exudative age-related macular degeneration. Am J Ophthalmol. 1998;125(3):353–359. [CrossRef] [PubMed]
Zareparsi S Reddick AC Branham KEH . Association of apolipoprotein E alleles with susceptibility to age-related macular degeneration in a large cohort from a single center. Invest Ophthalmol Vis Sci. 2004;45(5):1306–1310. [CrossRef] [PubMed]
Utermann G Langenbeck U Beisiegel U Weber W . Genetics of the apolipoprotein E system in man. Am J Hum Genet. 1980;32(3):339–347. [PubMed]
Bojanowski CM Shen D Chew EY . An apolipoprotein E variant may protect against age-related macular degeneration through cytokine regulation. Environ Mol Mutagen. 2006;47(8):594–602. [CrossRef] [PubMed]
Fritsche LG Freitag-Wolf S Bettecken T . Age-related macular degeneration and functional promoter and coding variants of the apolipoprotein E gene. Hum Mutat. 2009;30(7):1048–1053. [CrossRef] [PubMed]
Boyles JK Zoellner CD Anderson LJ . A role for apolipoprotein E, apolipoprotein A-I, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of the rat sciatic nerve. J Clin Invest. 1989;83(3):1015–1031. [CrossRef] [PubMed]
Erdman JWJr Bierer TL Gugger ET . Absorption and transport of carotenoids. Ann N Y Acad Sci. 1993;691:76–85. [CrossRef] [PubMed]
Goulinet S Chapman MJ . Plasma LDL and HDL subspecies are heterogenous in particle content of tocopherols oxygenated and hydrocarbon carotenoids: relevance to oxidative resistance and atherogenesis. Arterioscler Thromb Vasc Biol. 1997;17(4):786–796. [CrossRef] [PubMed]
Yeum KJ Russell RM . Carotenoid bioavailability and bioconversion. Annu Rev Nutr. 2002;22:483–504. [CrossRef] [PubMed]
Leon AS Togashi K Rankinen T . Association of apolipoprotein E polymorphism with blood lipids and maximal oxygen uptake in the sedentary state and after exercise training in the HERITAGE family study. Metabolism. 2004;53(1):108–116. [CrossRef] [PubMed]
Willett WC . Future directions in the development of food-frequency questionnaires. Am J Clin Nutr. 1994;59(1):S171–S174.
Bodner CH Soutar A New SA . Validation of a food frequency questionnaire for use in a Scottish population: correlation of antioxidant vitamin intakes with biochemical measures. J Hum Nutr Dietetics. 1998;11(5):373–380. [CrossRef]
Masson LF McNeill G Tomany JO . Statistical approaches for assessing the relative validity of a food-frequency questionnaire: use of correlation coefficients and the kappa statistic. Public Health Nutr. 2003;6(3):313–321. [CrossRef] [PubMed]
O'Connell ED Nolan JM Stack J . Diet and risk factors for age-related maculopathy. Am J Clin Nutr. 2008;87(3):712–722. [PubMed]
Nolan JM Stack J Mellerio J Godhinio M O'Donovan O Beatty S . Monthly consistency of macular pigment optical density and serum concentrations of lutein and zeaxanthin. Curr Eye Res. 2006;31(2):199–213. [CrossRef] [PubMed]
Holland B Welch AA Unwin ID Buss DH Paul AA Southgate DAT . McCance and Widdowson's The Composition of Foods. Fifth revised and extended edition. London: Food Standards Agency; 1991.
O'Neill ME Carroll Y Corridan B . A European carotenoid database to assess carotenoid intakes and its use in a five-country comparative study. Br J Nutr. 2001;85(4):499–507. [CrossRef] [PubMed]
United States Department of Agriculture. USDA-NCC Carotenoid Database for U.S. Foods—1998. http://www.nal.usda.gov/fnic/foodcomp/Data/car98/car98.html . Accessed January 2, 2010.
Foods Standards Agency. McCance and Widdowson's The Composition of Foods. Sixth summary edition. Cambridge: Royal Society of Chemistry; 2002.
Rand WM Windham CT Wyse BW Young VR . Compiling Data for Food Composition Databases. Tokyo: United Nations University Press; 1991.
Bone RA Landrum JT Cains A . Optical density spectra of the macular pigment in vivo and in vitro. Vis Res. 1992;32(1):105–110. [CrossRef] [PubMed]
Wooten BR Hammond BR Land RI Snodderly DM . A practical method for measuring macular pigment optical density. Invest Ophthalmol Vis Sci. 1999;40(11):2481–2489. [PubMed]
Nolan JM Stringham JM Beatty S Snodderly DM . Spatial profile of macular pigment and its relationship to foveal architecture. Invest Ophthalmol Vis Sci. 2008;49(5):2134–2142. [CrossRef] [PubMed]
Loane E Stack J Beatty S Nolan JM . Measurement of macular pigment optical density using two different heterochromatic flicker photometers. Curr Eye Res. 2007;32(6):555–564. [CrossRef] [PubMed]
Mellerio J Ahmadi-Lari S van Kuijk FJGM Pauleikhoff D Bird AC Marshall J . A portable instrument for measuring macular pigment with central fixation. Curr Eye Res. 2002;25(1):37–47. [CrossRef] [PubMed]
Beatty S Murray IJ Henson DB Carden D Koh HH Boulton ME . Macular pigment and risk for age-related macular degeneration in subjects from a Northern European population. Invest Ophthalmol Vis Sci. 2001;42(2):439–446. [PubMed]
Snodderly DM Mares JA Wooten BR Oxton L Gruber M Ficek T . Macular pigment measurement by heterochromatic flicker photometry in older subjects: the carotenoids and age-related eye disease study. Invest Ophthalmol Vis Sci. 2004;45(2):531–538. [CrossRef] [PubMed]
Ciulla TA Curran-Celantano J Cooper DA . Macular pigment optical density in a midwestern sample. Ophthalmology. 2001;108(4):730–737. [CrossRef] [PubMed]
Hammond BR Caruso-Avery M . Macular pigment optical density in a southwestern sample. Invest Ophthalmol Vis Sci. 2000;41(6):1492–1497. [PubMed]
Bennet AM Di AE Ye Z . Association of apolipoprotein E genotypes with lipid levels and coronary risk. JAMA. 2007;298(11):1300–1311. [CrossRef] [PubMed]
Laws SM Hone E Gandy S Martins RN . Expanding the association between the APOE gene and the risk of Alzheimer's disease: possible roles for APOE promoter polymorphisms and alterations in APOE transcription. J Neurochem. 2003;84(6):1215–1236. [CrossRef] [PubMed]
Thakkinstian A Bowe S McEvoy M Smith W Attia J . Association between apolipoprotein E polymorphisms and age-related macular degeneration: a HuGE review and meta-analysis. Am J Epidemiol. 2006;164(9):813–822. [CrossRef] [PubMed]
Schmidt S Klaver C Saunders A . A pooled case-control study of the apolipoprotein E (APOE gene in age-related maculopathy. Ophthalmic Genet. 2002;23(4):209–223. [CrossRef] [PubMed]
Friedman DA Lukiw WJ Hill JM . Apolipoprotein E epsilon4 offers protection against age-related macular degeneration. Med Hypotheses. 2007;68(5):1047–1055. [CrossRef] [PubMed]
Loane E Kelliher C Beatty S Nolan JM . The rationale and evidence base for a protective role of macular pigment in age-related maculopathy. Br J Ophthalmol. 2008;92(9):1163–1168. [CrossRef] [PubMed]
Krinsky NI Deneke SM . Interaction of oxygen and oxy-radicals with carotenoids. J Natl Cancer Inst. 1982;69(1):205–210. [PubMed]
Lim BP Nagao A Terao J Tanaka K Suzuki T Takama K . Antioxidant activity of xanthophylls on peroxyl radical-mediated phospholipid peroxidation. Biochim Biophys Acta. 1992;1126(2):178–184. [CrossRef] [PubMed]
Snodderly DM Auran JD Delori FC . The macular pigment, II: spatial distribution in primate retinas. Invest Ophthalmol Vis Sci. 1984;25(6):674–685. [PubMed]
Ham WTJr Mueller HA Sliney DH . Retinal sensitivity to damage from short wavelength light. Nature. 1976;260(5547):153–155. [CrossRef] [PubMed]
Organisciak DT Darrow RA Barsalou L Darrow RM Lininger LA . Light-induced damage in the retina: differential effects of dimethylthiourea on photoreceptor survival, apoptosis and DNA oxidation. Photochem Photobiol. 1999;70(2):261–268. [CrossRef] [PubMed]
Khachik F Bernstein PS Garland DL . Identification of lutein and zeaxanthin oxidation products in human and monkey retinas. Invest Ophthalmol Vis Sci. 1997;38(9):1802–1811. [PubMed]
Kennedy CJ Rakoczy PE Constable IJ . Lipofuscin of the retinal pigment epithelium: a review. Eye. 1995;9:763–771. [CrossRef] [PubMed]
Rozanowska M Jarvis-Evans J Korytowski W Boulton ME Burke JM Sarna T . Blue light-induced reactivity of retinal age pigment: in vitro generation of oxygen-reactive species. J Biol Chem. 1995 270(32):18825–18830. [CrossRef] [PubMed]
Boulton M Dontsov A Jarvisevans J Ostrovsky M Svistunenko D . Lipofuscin is a photoinducible free-radical generator. J Photochem Photobiol B-Biol. 1993;19(3):201–204. [CrossRef]
Wing GL Blanchard GC Weiter JJ . Topography and age relationship of lipofuscin concentration in retinal-pigment epithelium. Invest Ophthalmol Vis Sci. 1978;17(7):601–607. [PubMed]
Weiter JJ Delori FC Wing GL Fitch KA . Retinal pigment epithelial lipofuscin and melanin and choroidal melanin in human eyes. Invest Ophthalmol Vis Sci. 1986;27(2):145–152. [PubMed]
Reboul E Abou L Mikail C . Lutein transport by Caco-2 TC-7 cells occurs partly by a facilitated process involving the scavenger receptor class B type I (SR-BI. Biochem J. 2005;387(pt 2):455–461. [PubMed]
Clevidence BA Bieri JG . Association of carotenoids with human plasma lipoproteins. Methods Enzymol. 1993;214:33–46. [PubMed]
Connor WE Duell PB Kean R Wang Y . The prime role of HDL to transport lutein into the retina: evidence from HDL-deficient WHAM chicks having a mutant ABCA1 transporter. Invest Ophthalmol Vis Sci. 2007;48(9):4226–4231. [CrossRef] [PubMed]
Wang W Connor SL Johnson EJ Klein ML Hughes S Connor WE . Effect of dietary lutein and zeaxanthin on plasma carotenoids and their transport in lipoproteins in age-related macular degeneration. Am J Clin Nutr. 2007;85(3):762–769. [PubMed]
Bhosale P Larson AJ Frederick JM Southwick K Thulin CD Bernstein PS . Identification and characterization of a Pi isoform of glutathione S-transferase (GSTP1 as a zeaxanthin-binding protein in the macula of the human eye. J Biol Chem. 2004;279(47):49447–49454. [CrossRef] [PubMed]
Bernstein PS Balashov NA Tsong ED Rando RR . Retinal tubulin binds macular carotenoids. Invest Ophthalmol Vis Sci. 1997;38(1):167–175. [PubMed]
Bhosale P Li B Sharifzadeh M . Purification and partial characterization of a lutein-binding protein from human retina. Biochemistry. 2009;48(22):4798–4807. [CrossRef] [PubMed]
Mahley RW Innerarity TL Rall SCJr Weisgraber KH . Plasma lipoproteins: apolipoprotein structure and function. J Lipid Res. 1984;25(12):1277–1294. [PubMed]
Gregg RE Zech LA Schaefer EJ Stark D Wilson D Brewer HBJr . Abnormal in vivo metabolism of apolipoprotein E4 in humans. J Clin Invest. 1986;78(3):815–821. [CrossRef] [PubMed]
Anderson DH Ozaki S Nealon M . Local cellular sources of apolipoprotein E in the human retina and retinal pigmented epithelium: implications for the process of drusen formation. Am J Ophthalmol. 2001;131(6):767–781. [CrossRef] [PubMed]
Shanmugaratnam J Berg E Kimerer L . Retinal Muller glia secrete apolipoproteins E and J which are efficiently assembled into lipoprotein particles. Brain Res Mol Brain Res. 1997;50(1–2):113–120. [CrossRef] [PubMed]
Dentchev T Milam AH Lee VM Trojanowski JQ Dunaief JL . Amyloid-beta is found in drusen from some age-related macular degeneration retinas, but not in drusen from normal retinas. Mol Vis. 2003;9:184–190. [PubMed]
Dithmar S Curcio CA Le NA Brown S Grossniklaus HE . Ultrastructural changes in Bruch's membrane of apolipoprotein E-deficient mice. Invest Ophthalmol Vis Sci. 2000;41(8):2035–2042. [PubMed]
Conley YP Thalamuthu A Jakobsdottir J . Candidate gene analysis suggests a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy. Hum Mol Genet. 2005;14(14):1991–2002. [CrossRef] [PubMed]
Gotoh N Kuroiwa S Kikuchi T . Apolipoprotein E polymorphisms in Japanese patients with polypoidal choroidal vasculopathy and exudative age-related macular degeneration. Am J Ophthalmol. 2004;138(4):567–573. [CrossRef] [PubMed]
Pang CP Baum L Chan WM Lau TC Poon PM Lam DS . The apolipoprotein E epsilon4 allele is unlikely to be a major risk factor of age-related macular degeneration in Chinese. Ophthalmologica. 2000;214(4):289–291. [CrossRef] [PubMed]
Schmidt S Haines JL Postel EA . Joint effects of smoking history and APOE genotypes in age-related macular degeneration. Mol Vis. 2005;11:941–949. [PubMed]
Schultz DW Klein ML Humpert A . Lack of an association of apolipoprotein E gene polymorphisms with familial age-related macular degeneration. Arch Ophthalmol. 2003;121(5):679–683. [CrossRef] [PubMed]
Wong TY Shankar A Klein R . Apolipoprotein E gene and early age-related maculopathy: the Atherosclerosis Risk in Communities Study. Ophthalmology. 2006;113(2):255–259. [CrossRef] [PubMed]
Utheim OA Ritland JS Utheim TP . Apolipoprotein E genotype and risk for development of cataract and age-related macular degeneration. Acta Ophthalmol. 2008;86(4):401–403. [CrossRef] [PubMed]
Stewart JE Skinner ER Best PV . Receptor binding of an apolipoprotein E-rich subfraction of high density lipoprotein to rat and human brain membranes. Int J Biochem Cell Biol. 1998;30(3):407–415. [CrossRef] [PubMed]
Figure 1.
 
MPOD spatial profile for subject 1.
Figure 1.
 
MPOD spatial profile for subject 1.
Figure 2.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Figure 2.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Figure 3.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Figure 3.
 
Box plots showing MPOD area versus ApoE genotype for all subjects.
Table 1.
 
ApoE Genotype Distribution for All Subjects
Table 1.
 
ApoE Genotype Distribution for All Subjects
ApoE Genotype Entire Group (n = 300) Negative Family History (n = 179) Positive Family History (n = 121)
Group 1 (ε2ε2, ε2ε3) 40 25 15
Group 2 (ε3ε3) 190 113 77
Group 3 (ε2ε4, ε3ε4, ε4ε4) 70 41 29
Table 2.
 
Anthropometric and Lifestyle Data for All Subjects According to ApoE Genotype Group
Table 2.
 
Anthropometric and Lifestyle Data for All Subjects According to ApoE Genotype Group
Characteristic Group 1 (n = 40) Group 2 (n = 190) Group 3 (n = 70)
Age, y 49.20 ± 10.80 48.37 ± 11.50 45.83 ± 9.76
Sex, n %
    Male 12 (30) 54 (28.4) 24 (34.3)
    Female 28 (70) 136 (71.6) 46 (65.7)
BMI* 26.29 ± 3.92 26.79 ± 4.71 26.64 ± 4.52
MPOD† 0.25° 0.50 ± 0.24 0.45 ± 0.20 0.56 ± 0.19
MPOD 0.5° 0.38 ± 0.17 0.36 ± 0.17 0.43 ± 0.18
MPOD 1° 0.24 ± 0.12 0.22 ± 0.12 0.29 ± 0.14
MPOD 1.75° 0.12 ± 0.09 0.12 ± 0.09 0.15 ± 0.11
MPOD area 0.70 ± 0.40 0.67 ± 0.42 0.85 ± 0.46
Smoking, pack-years‡ 5.33 ± 13.76 5.69 ± 10.35 5.82 ± 12.40
Dietary L, mg 1.376 ± 1.695 1.421 ± 1.113 1.234 ± 0.857
Dietary Z, mg 0.189 ± 0.150 0.189 ± 0.107 0.181 ± 0.091
Serum L, μg/mL 0.085 ± 0.047 0.089 ± 0.047 0.092 ± 0.049
Serum Z, μg/mL 0.016 ± 0.014 0.017 ± 0.017 0.017 ± 0.010
Positive family history of AMD, % 37.5 40.5 41.4
Table 3.
 
MPOD Values at Each Retinal Eccentricity According to ApoE Genotype, with the ε4ε4 Genotype Analyzed Separately
Table 3.
 
MPOD Values at Each Retinal Eccentricity According to ApoE Genotype, with the ε4ε4 Genotype Analyzed Separately
Characteristic Group 1 ε2ε2 or ε2ε3 (n = 39) Group 2 ε3ε3 (n = 187) Group 3 ε2ε4 or ε3ε4 (n = 63) Group 4 ε4ε4 (n = 6)
MPOD 0.25° 0.50 ± 0.24 0.45 ± 0.20 0.55 ± 0.19 0.62 ± 0.26
MPOD 0.5° 0.38 ± 0.17 0.36 ± 0.17 0.42 ± 0.18 0.49 ± 0.22
MPOD 1° 0.24 ± 0.12 0.22 ± 0.12 0.29 ± 0.14 0.26 ± 0.16
MPOD 1.75° 0.12 ± 0.09 0.12 ± 0.09 0.15 ± 0.11 0.15 ± 0.06
MPOD Area 0.70 ± 0.40 0.67 ± 0.42 0.85 ± 0.47 0.87 ± 0.37
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×