April 2010
Volume 51, Issue 4
Free
Retina  |   April 2010
Association of NR2E3 but Not NRL Mutations with Retinitis Pigmentosa in the Chinese Population
Author Affiliations & Notes
  • Yaping Yang
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Xin Zhang
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Li Jia Chen
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Sylvia W. Y. Chiang
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Pancy O. S. Tam
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Timothy Y. Y. Lai
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Carmen K. M. Chan
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Ningli Wang
    the Beijing Tong Ren Hospital, Capital Medical University, Beijing, China.
  • Dennis S. C. Lam
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Chi Pui Pang
    From the Department of Ophthalmology and Visual Sciences, the Chinese University of Hong Kong, Hong Kong; and
  • Corresponding author: Chi Pui Pang, Department of Ophthalmology and Visual Sciences, The Chinese University of Hong Kong, Hong Kong Eye Hospital, 147K Argyle Street, Kowloon, Hong Kong; cppang@cuhk.edu.hk
  • Footnotes
    2  Contributed equally to the work and therefore should be considered equivalent authors.
  • Footnotes
    3  Present affiliation: Department of Ophthalmology, Ningxia People's Hospital, Ningxia, China.
Investigative Ophthalmology & Visual Science April 2010, Vol.51, 2229-2235. doi:10.1167/iovs.09-4299
  • Views
  • PDF
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      Yaping Yang, Xin Zhang, Li Jia Chen, Sylvia W. Y. Chiang, Pancy O. S. Tam, Timothy Y. Y. Lai, Carmen K. M. Chan, Ningli Wang, Dennis S. C. Lam, Chi Pui Pang; Association of NR2E3 but Not NRL Mutations with Retinitis Pigmentosa in the Chinese Population. Invest. Ophthalmol. Vis. Sci. 2010;51(4):2229-2235. doi: 10.1167/iovs.09-4299.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose.: Mutations in the NR2E3 and NRL genes have been implicated in both autosomal dominant and autosomal recessive retinitis pigmentosa (RP). In this study, the mutation profiles of these two genes were investigated in Chinese RP patients.

Methods.: In 172 RP patients and 360 normal control subjects (180 from Hong Kong and 180 from Beijing), the coding exons and the exon–intron boundaries of NR2E3 and NRL were screened by direct DNA sequencing after PCR. Association analysis was performed for common single-nucleotide polymorphisms (SNPs), whereas in silico programs were used for analysis of rare missense variants.

Results.: In NR2E3, 14 novel sequence changes have been identified. Two missense variants, p.G56R and p.V118M, were exclusively found in RP patients with frequencies at 1.2% (2/172) and 1.7% (3/172), respectively. All five patients were found to be heterozygous for these two mutations. Computational analysis suggested functional defects on the NR2E3 protein, indicating disease-causing roles. The p.E121K variant of NR2E3, which reportedly caused enhanced S-cone syndrome (ESCS) in Caucasians, was found concurrently in RP patients (13.4%) and control subjects from Hong Kong (10.5%) and Beijing (12.8%). In NRL, six novel sequence changes were identified, none of them associated with RP.

Conclusions.: In this study, NR2E3 mutations (p.G56R, p.V118M) were found to be responsible for approximately 2.9% of overall RP in Chinese patients, comparable to the contributions of RHO and RP1 mutations. The p.E121K in NR2E3 is a common SNP in the Chinese, suggesting another genetic or environmental factor is involved in its causative role in ESCS in Caucasians.

Retinitis pigmentosa (RP; MIM 268000; Mendelian Inheritance in Man; National Center for Biotechnology Information, Bethesda, MD) refers to a group of inherited and degenerative retinal diseases due to the death of rod photoreceptors in the retina with high phenotypic and genetic heterogeneity. Affected individuals usually experience early-onset night blindness followed by progressive loss of peripheral vision, decline in the electroretinograph (ERG), atrophy and pigmentary changes to the retinal pigment epithelium (RPE), and eventual loss of central vision or complete blindness. The worldwide prevalence of RP is approximately 1:3000 to 1:5000, affecting more than 1 million individuals. 16 RP can follow Mendelian modes of inheritance or present as rare mitochondrial and digenic forms. 7 Major inheritance patterns include autosomal–dominant (15%–20%), autosomal–recessive (20%–25%), and X-linked (10%–15%). The remaining 40% to 55% of cases are classified as simplex RP, because of absent family history or segregation pattern. 8,9 To date, at least 21, 29, and 6 genes or chromosomal loci have been identified for autosomal dominant (AD)RP, autosomal recessive (AR)RP and X-linked (XL)RP, respectively (RetNet, the Retinal Information Network, http://www.sph.uth.tmc.edu/RetNet; provided in the public domain by the University of Texas Houston Health Science Center, Houston, TX, accessed October 1, 2009). Among them, four genes—RHO (rhodopsin, MIM 180380), RP1 (retinitis pigmentosa 1, MIM 603937), NR2E3 (photoreceptor-specific nuclear receptor, MIM 604485), and NRL (neural retina leucine zipper, MIM 162080)—have been reported to be responsible for both ADRP and ARRP. Mutation profiles of RHO and RP1 in RP are documented in different ethnic groups. In Caucasians, RHO mutations account for approximately 25% of ADRP and 1% of ARRP, whereas RP1 mutations account for approximately 5% and less than 1% of ADRP and ARRP, respectively. 1019 In the Chinese, RHO and RP1 contribute to approximately 2% and 1% of overall RP cases, respectively, much lower than in Caucasians. 2022  
NR2E3 encodes a member of the nuclear hormone receptor superfamily of ligand-modulated transcription factors that repress cone-specific genes in rods. 23,24 NRL belongs to the basic motif-leucine zipper family of transcription factors and is essential in the regulation of early events leading to the development of rod photoreceptors. 25,26 Both NR2E3 and NRL are expressed predominantly in photoreceptor cells in the retina and act interactively with the cone-rod homeobox transcription factor (CRX, MIM 602225), to suppress cone-specific gene expression in mature rods and activate several rod-specific genes, including RHO. 23,24,2730 Lesions in these two genes may lead to dysfunction of the photoreceptors. The genes are thus associated with the pathogenesis of RP and other forms of retinal degeneration. NR2E3 mutations account for approximately 1.4% of ADRP and 0.25% of ARRP in Caucasians. 13,31 They have also been implicated in the recessively inherited enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), and clumped pigmentary retinal degeneration (CPRD). 32 However, the NR2E3 mutations responsible for ESCS, GFS, and CPRD do not overlap with those associated with RP, except for p.R311Q, which is involved in four major types of retinal degenerations in humans. 32 The heterozygous mutation p.G56R, located in the first zinc finger of the DNA-binding domain (DBD), is the most common causative mutation for ADRP in the NR2E3 sequence. 31,33,34 NR2E3 mutations have been correlated with specific phenotypes (www.LOVD.nl/eye; Leiden Open Variation Database, provided in the public domain by Leiden University Medical Center, Leiden, The Netherlands). 32 NRL mutations contribute to approximately 1% of ADRP and less than 1% of ARRP in Caucasians. 13 Most RP-causative mutations in the NRL sequence were missense changes affecting three residues: S50, P51, and G122. 35,36 Loss-of-function mutations in NRL have also been found in patients with CPRD 37 and ESCS. 38 In the Chinese, however, involvement of NR2E3 and NRL mutations in RP has not been investigated. In the present study, we report the mutation patterns of these two genes in Chinese RP patients. 
Materials and Methods
Study Subjects
The patients in this study were recruited from the eye clinics of Hong Kong Eye Hospital and Prince of Wales Hospital in Hong Kong. They were given complete ophthalmic examinations, including slit-lamp biomicroscopy, fundus photography and electroretinography. Diagnosis of nonsyndromic RP was based on typical clinical history and features of RP. Patients with syndromic RP, such as Usher's syndrome, Leber congenital amaurosis, and Bardet-Biedl syndrome, were excluded. In total, 172 RP patients were recruited, including 92 males and 80 females, with ages ranging from 6 to 84 years. Based on family history, 18 (10.5%) of the patients were classified as having ADRP, 26 (15.1%) as having ARRP, 2 (1.2%) as having XLRP, and 97 (56.4%) as having simplex RP; 29 (16.8%) patients could not be classified because of absent family information. They therefore had unknown inheritance patterns and might represent a group with nonsyndromic RP of mixed phenotypes. Also recruited were 180 control subjects, older than 60 years. They were confirmed to be free of RP or other major eye diseases, except mild senile cataract, by detailed ophthalmic examination. In addition, a group of 180 normal control subjects from Beijing, which is located in northern China, were also recruited. They were examined at Beijing Tongren Hospital and were described in our previous study. 31 All study subjects were ethnic Chinese. 
Informed consents were obtained from all the subjects participating in this study. The study protocol was approved by the Ethics Committee on Human Research, the Chinese University of Hong Kong, and by the respective human subjects review boards at each participating academic institution. All procedures were performed in accordance with the Declaration of Helsinki. 
Mutational Screening of NR2E3 and NRL in Cases and Controls
Peripheral venous blood was collected from all study subjects for extraction of genomic DNA (QIAamp DNA Blood kit; Qiagen, Valencia, CA) according to the supplier's instructions. Polymerase chain reaction (PCR) primers were designed according to sequences from the Ensembl database 39 (Table 1). In total, six amplicons covering coding exons 1 to 9 and part of the promoter sequence of NR2E3 and two amplicons covering coding exons 1 and 2 of NRL were amplified by PCR for direct DNA sequencing with dye-termination chemistry (BigDye Terminator Cycle Sequencing Reaction Kit; ver. 3.1; Applied Biosystems, Inc. [ABI], Foster City, CA) on a DNA sequencer (model 3130XL; ABI), according to the supplier's protocol. The DNA sequences were compared with the human NR2E3 (ENSG00000031544) and NRL (ENSG00000129535) sequences in the Ensembl database. Detected sequence variants in any DNA sample were confirmed by bidirectional sequencing on another stock DNA sample. 
Table 1.
 
Primer Sequences and Thermal Cycling Conditions for NR2E3 and NRL Screening
Table 1.
 
Primer Sequences and Thermal Cycling Conditions for NR2E3 and NRL Screening
Primer Primer Sequence (5′→3′) PCR Product Size (bp) PCR Conditions
NR2E3 1-F TGTGGAGACAGTAAAGATTAAGAGG 461 2.0 mM MgCl2; 56°C
NR2E3 1-R AGTTGTTCTGGCTCCTTCCAT
NR2E3 2/3-F CGTGGGTTCGTTCAAATGC 670 1.5 mM MgCl2; 56°C
NR2E3 3-R CAGTGTTGGACTCCATGCTG
NR2E3 4/5-F GGCTGAAGAAGTGCCTGCA 756 1.5 mM MgCl2; 56°C
NR2E3 5-R CCCTGTCTGGTTGACTCGAGT
NR2E3 6/7/8-F AGGACAGCACTTCCATTCCTTGG 935 1.5 mM MgCl2; 56°C
NR2E3 8R TTGTGCTGTCTAATCAGTGAGCTC
NR2E3 9F AAATTCCTCCTGACCCACTCTG 365 2.0 mM MgCl2; 56°C
NR2E3 9R ACACCTACGAGGAATTGCTGG
NR2E3 P1F TTCAAGATGTGGCATGAAATGG 286 2.0 mM MgCl2; 56°C
NR2E3 P1R AACTCTGTCTGAACTCAGGAGCTG
NRL 1F CTGGCTTTCCCAAACTCTTG 664 1.5 mM MgCl2; 62°C
NRL 1R CTTTCAAGGGACCTTCTCCC
NRL 2F GAAACAGACTGCGTGGAAGG 567 1.5 mM MgCl2; 62°C TD(−0.2)
NRL 2R TAACGATGCAGAGAACCGTG 30 cycles + 56°C 10 cycles
Statistical Analysis and Analysis of Variants
For the common polymorphisms, χ2 analysis was used to test Hardy-Weinberg Equilibrium (HWE) and to compare the genotype frequencies of the single-nucleotide polymorphisms (SNPs) between RP patients and controls using SPSS (ver. 15.0, SPSS Inc., Chicago, IL). The Bonferroni method was used to correct the P-values in multiple comparisons. A corrected P < 0.05 was considered statistically significant. For the rare missense variants detected exclusively in patients, three Web-based analysis programs—PolyPhen (Polymorphism Phenotyping, http://genetics.bwh.harvard.edu/pph/ provided by the Bork Group and the Sunyaev Lab, Brigham and Women's Hospital, Harvard Medical School, Boston, MA), SIFT (Sorting Intolerant from Tolerant, http://sift.jcvi.org/ provided in the public domain by the J. Craig Venter Institute, Rockville, MD), and Grantham Score (The Single Amino Acid Polymorphism Disease-association Predictor, http://sapred.cbi.pku.edu.cn/ provided by the Sapred Team, Center for Bioinformatics, Peking University, Beijing, China), were used to evaluate and predict the possible functional effects of the amino acid substitutions on the proteins. 
Results
Variants Detected in the NR2E3 Gene
Among the 172 RP patients and 360 control subjects, a total of 20 sequence changes in the NR2E3 gene was identified, 14 of them novel (Table 2). Eight variants (c.119-47C>T, c.119-28T>C, c.119-28_119-13del, c.245+75G>A, c.349+8G>A, c.1101-87C>T, c.1101-47G>A, and c.1230+53C>T) were located in noncoding regions, four (p.I61I, p.L277L, p.P281P, and p.A321A) were synonymous changes, and eight (p.G56R, p.V118M, p.E121K, p.E140G, p.M163T, p.T300M, p.V302I, and p.P375L) were missense changes. 
Table 2.
 
Sequence Variations Detected in the NR2E3 and NRL Genes among Chinese RP Patients and Control Subjects
Table 2.
 
Sequence Variations Detected in the NR2E3 and NRL Genes among Chinese RP Patients and Control Subjects
Location Nucleotide Change Residual Change Description Genotype Frequency*
Patients (n = 172) Controls (n = 180)
NR2E3 variants†
    Intron 1 c.119-47C>T Novel 0/3/169 2/4/174‡
    Intron 1 c.119-28T>C rs2742318 1/6/164 2/13/165‡
    Intron 1 c.119-28_119-13del Novel 0/1/171 0/0/180
    Exon 2 c.166G>A p.G56R Reported 33 0/2/170 0/0/180
    Exon 2 c.183C>T p.1611 Novel 0/0/172 0/1/179
    Intron 2 c.245+75G>A Novel 0/1/171 0/0/180
    Intron 3 c.349+8G>A Novel 1/8/163 0/6/174
    Exon 4 c.352G>A p.V118M Novel 0/3/169 0/0/180
    Exon 4 c.361G>A p.E121K Reported 40 1/22/149 4/14/162‡
    Exon 4 c.419A>G p.E140G rs1805020 2/37/133 4/37/139
    Exon 4 c.488T>C p.M163T rs1805021 2/40/130 4/34/142
    Exon 6 c.829C>T p.L277L Novel 0/1/171 0/0/180
    Exon 6 c.843C>T p.P281P Novel 0/1/171 0/0/180
    Exon 6 c.899C>T p.T300M Novel 0/0/172 0/1/179
    Exon 6 c.904 G>A p.V3021 rs1805025 0/13/159 0/6/174
    Exon 7 c.963 C>T p.A321A Novel 0/5/167 0/4/176
    Intron 8 c.1101-87C>T Novel 0/0/172 0/1/179
    Intron 8 c.1101-47G>A Novel 0/0/172 0/1/179
    Exon 9 c.1124C>T p.P375L Novel 0/0/172 0/1/179
    3′UTR c.1230+53C>T Novel 0/1/171 0/0/180
NRL variants†
    Exon 2 c.97G>C p.G33R Novel 0/0/172 0/1/179
    Exon 2 c.105T>C p.P35P Novel 0/0/172 0/1/179
    Exon 2 c.108A>C p.T36T Novel 0/0/172 0/1/179
    Exon 2 c.112T>C p.S38P Novel 0/0/172 0/1/179
    Exon 2 c.126A>G p.T42T Novel 0/1/171 0/0/180
    Exon 3 c.450G>C p.R150R Novel 0/2/170 0/0/180
Three of the missense variants, p.E140G (rs1805020), p.M163T (rs1805021), and p.V302I (rs1805025), and one intronic variant, c.119-28T>C (rs2742318), were common SNPs registered in the dbSNP database (provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). They occurred at high frequencies among RP patients and control subjects (Table 2). Besides, three novel variants, c.119-47C>T, c.349+8G>A, and c.963 C>T (p.A321A), were present in more than 1% of both patients and controls and are considered as SNPs. Except for three (c.119-47C>T, c.119-28T>C, and p.E121K), the SNPs showed HWE. However, none of these SNPs was significantly associated with RP (P corr > 0.05). Notably, a missense change p.E121K, which was reported as a disease-causing mutation of the autosomal recessive retinopathy ESCS, 40 was found to occur concurrently in the RP patients (Homo/Het/Wt [homologous/heterologous/wild-type] 1 [0.58%]/22 [12.79%]/149 [86.63%]) and control subjects (Hong Kong cohort, 4 [2.33%]/14 [8.14%]/162 [94.19%]; Beijing cohort, 7 [4.07%]/15 [8.72%]/158 (91.86%]). Both heterozygous and homozygous genotypes were detected in patients and controls. A χ2 analysis showed that SNP p.E121K was not associated with RP (P > 0.05), and the genotype and allele frequencies of this SNP were comparable between the control subjects from Hong Kong and Beijing (P > 0.05). 
Apart from the common polymorphisms, we also identified rare variants in NR2E3. Among them, five (p.I61I, p.T300M, c.1101-47G>A, c.1101-87C>T, and p.P375L) were found only in control individuals, whereas another seven (c.119-28_119-13del, c.245+75G>A, p.G56R, p.V118M, p.L277L, p.P281P, and c.1230+53C>T) occurred exclusively in RP patients. Among them, the two missense variants, p.G56R and p.V118M, could be considered disease-causing mutations because (1) they lead to nonsynonymous amino acid changes in the NR2E3 protein; (2) each of them was found in more than one RP patient, with p.G56R in two patients with ADRP and p.V118M in three patients, two of them SRP (simplex RP) and one of unknown inheritance pattern (Table 3); and (3) both variants were absent in the 360 normal control individuals. Patients carrying p.G56R and p.V118M were all heterozygous. They had typical RP features on fundus photography, including optic disc pallor, attenuated retinal vessels, and diffuse pigmentary changes over the retina. Their visual field and electroretinography were also subnormal (data not shown). 
Table 3.
 
Demographic and Clinical Features of Carriers of NR2E3 Mutations
Table 3.
 
Demographic and Clinical Features of Carriers of NR2E3 Mutations
Mutation Subject Sex Age at Diagnosis* Inheritance Pattern
p.G56R HKRP397 F 54 ADRP
p.G56R HKRP466 F 56 ADRP
p.V118M HKRP442 F 51 Unknown
p.V118M HKRP195 F 52 SRP
p.V118M HKRP210 M 71 SRP
To evaluate the functional significance of these variants, we performed multiple protein sequence alignments of NR2E3 to compare the sequences of human, murine, chimp, dog, chicken, and frog by a Web-based program (T-Coffee, ver. 7.71 (http://www.tcoffee.org/ provided in the public domain by the Center for Genomic Regulation, Barcelona, Spain). 41 The results showed that positions 56 (G) and 118 (V) on NR2E3 are conserved across species (Fig. 1). Furthermore, all three in silico programs predicted possible impacts of p.G56R and p.V118M on the NR2E3 protein function (Table 4). The variant p.G56R was predicted as “probably damaging” by PolyPhen with a PSIC (position-specific independent count) score of 2.844, and as “damaging” by SIFT with a score of 0.02. The Grantham score for this substitution was 125. Based on these predictions, the p.G56R variant was likely to be a functional mutation, consistent with the previous prediction by Coppieters et al. 33 The novel variant p.V118M was predicted to be “probably damaging” by PolyPhen with a PSIC score of 2.163, and “damaging” by SIFT with a score of 0.00. The Grantham score for this substitution was 21. Therefore, p.V118M was potentially RP causative. 
Figure 1.
 
Multiple sequence alignment for NR2E3 (partially). Sequences of human (Homo sapiens NP_055064.1), chimp (Pan troglodytes XP_001175020.1 ), dog (Canis familiaris XP_544754.2), mouse (Mus musculus NP_038736.1), chicken (Gallus gallus NP_989925.1), and frog (Xenopus tropicalis NP_001090633.1).
Figure 1.
 
Multiple sequence alignment for NR2E3 (partially). Sequences of human (Homo sapiens NP_055064.1), chimp (Pan troglodytes XP_001175020.1 ), dog (Canis familiaris XP_544754.2), mouse (Mus musculus NP_038736.1), chicken (Gallus gallus NP_989925.1), and frog (Xenopus tropicalis NP_001090633.1).
Table 4.
 
Evaluation of Pathogenic Potential of Missense Mutations of NR2E3
Table 4.
 
Evaluation of Pathogenic Potential of Missense Mutations of NR2E3
Location Functional Domain Residual Change Cases (n = 172) Controls PolyPhen SIFT Grantham Score
Hong Kong Beijing Prediction PSIC Score Prediction Score
Exon 2 DBD p.G56R* 2 0/180 Probably damaging 2.844 Intolerant 0.02 125
Exon 4 DBD p.V118M 3 0/180 0/180 Probably damaging 2.163 Intolerant 0.00 21
Variants Detected in the NRL Gene
Six sequence changes were identified in the NRL gene, all are novel (Table 2). Four of them (p.G33R, p. P35P, p.T36T, and p. S38P) were found only in controls, and two (p.T42T, p.R150R) existed in patients exclusively. Except for the p.R150R, which was found in two patients, each variant was found in one study subject and only the heterozygous genotype was identified. 
Discussion
NR2E3 and NRL are both transcription factors and part of a complex pathway that controls the differentiation of postmitotic photoreceptor precursors. NRL is necessary for the precursor cells to differentiate to rod photoreceptors, 25,26 although the NR2E3 may interact with NRL to suppress cone-specific gene expression and to activate a subset of rod-specific genes. 23,28,29 Thus, functional mutations in these two genes are expected to result in improper differentiation of photoreceptors and cause rods and cones dysfunction, which lead to RP or other retinal disorders with rod/cone dystrophy. Mutations in both NR2E3 and NRL have been implicated in ESCS, 38,40,42 CPRD, 37,42,43 ADRP, and ARRP. 3134,36,44,45 NR2E3 mutations account for approximately 1.4% 31 ADRP and 0.25% 13 ARRP and NRL mutations account for 1% ADRP and less than 1% ARRP. 13 Assuming ADRP and ARRP contribute to 15% to 20% and 20% to 25% of all RP patients, respectively, 8,9 NR2E3 mutations should account for approximately 0.71% (0.014 × 0.15+0.025 × 0.20) to 0.91% (0.014 × 0.2+0.025 × 0.25) of overall RP, and NRL for 0.35% (0.01 × 0.15+0.01 × 0.20) to 0.45% (0.01 × 0.2+0.01 × 0.25). 
Among the NR2E3 sequence variants detected in our study in Chinese individuals, the four reported (rs2742318, rs1805020, rs1805021, and rs1805025) and three novel (c.119-47C>T, c.349+8G>A, and p.A321A) SNPs were not associated with RP. It is noted that a previously reported rare variant in Caucasians, p.E121K, was found at high frequency in our study population, evenly distributed in RP patients (13.4%) and control subjects (10.5% in the Hong Kong cohort and 12.8% in the Beijing cohort). In a study by Haider et al., 40 the p.E121K mutation was detected in one patient with ESCS but not in 500 control individuals. The p.E121K has not been reported by other studies, suggesting that it is a rare variant in Caucasians. However, in this study, it was a common SNP in a Chinese population. This variant has not been identified in the Han Chinese in Beijing (HCB) in the International HapMap project, probably because of the small sample size (n = 45) used in the HapMap project. In our present study, the control subjects who carry either one or two copies of the p.121K allele do not have any identifiable abnormalities at the peripheral retina or the macula. There were no visual dysfunctions in visual acuity or visual field or experience of nyctalopia. p.121K is thus nonpathogenic. In Haider et al., 40 heterozygous p.E121K was considered a disease-causing mutation for ESCS. However, as ESCS is an autosomal recessive retinopathy, heterozygous p.E121K may be insufficient to cause ESCS. Other genetic risk factors may have been involved. Recently, Fradot et al. 45 reported that NR2E3 p.E121K, located in the DNA-binding domain, was not defective in transcriptional inhibitory activity. This result is a supportive evidence that p.E121K does not cause functional defects in NR2E3, nor does it cause disease on its own. 
Five of the rare NR2E3 variants detected in this study were found in control individuals only and could be excluded as disease-causing mutations (Table 2). Among the seven variants that were identified exclusively in RP patients, c.119-28_119-13del, c.245+75G>A, p.L277L, p.P281P, and c.1230+53C>T are less likely to be disease causative, because they were either located in the noncoding regions or led to synonymous amino acid changes, although their involvement in the pathogenesis of RP via moderating transcription level or mRNA stability could not be completely excluded. The remaining two variants, p.G56R and p.V118M, are likely to be causative of RP. These two mutations were found in 1.2% (2/172) and 1.7% (3/172) of RP patients. The p.G56R, which is located in the first zinc-finger of the DNA-binding domain of NR2E3, has been implicated in ADRP in Caucasian populations, 31,33,34 contributing to approximately 1% to 2% of the ADRP population. 31 Based on segregation analysis and bioinformatics predictions, Coppieters et al. 33 hypothesized that the ADRP causing mutation, p.G56R, may predominantly influence the terminal differentiation and maintenance of rods through disruption of the transactivation of NR2E3, possibly through loss of interactions with other cofactors, like NRL and CRX. 33 Using functional analysis, Escher et al. 34 demonstrated that dominant negative activity—that is, competition for dimerization by a DNA binding-defective mutant—of the p.G56R mutant protein was involved in the molecular mechanism of ADRP. In this study, in silico programs showed that p.G56R caused deleterious functions of the NR2E3 protein, consistent with the predictions of Coppieters et al. 33 In our study subjects, the two p.G56R carriers were ADRP patients, both with disease diagnosed when they were in their 50s and both with severe visual field loss. Ocular examinations detected a few small spots of clumped pigmentation in peripheral retina, mild atrophic changes of the retinal epithelium in the macula, and typical attenuation of retinal vessels (Fig. 2). By contrast, in Caucasian studies, the phenotypes of the subjects carrying the p.G56R mutation were remarkable for severe rod loss in early childhood. 31  
Figure 2.
 
Fundus photo of the subject HKRP466, a carrier of the NR2E3 p.G56R mutation.
Figure 2.
 
Fundus photo of the subject HKRP466, a carrier of the NR2E3 p.G56R mutation.
Apart from p.G56R, we identified in three RP patients a novel NR2E3 mutation, p.V118M. This variant was absent in the 360 control subjects from Hong Kong or Beijing, suggesting that its occurrence in RP patients is less likely to be due to chance, and it could be pathogenic. The substitution of a valine with a methionine was predicted to be damaging to protein function by the PolyPhen and SIFT programs. However, the Grantham score of this substitution was 21, suggesting that the substitution is conservative and the impact may be milder. Multiple alignments of protein sequences showed that residue-118 (V) is conserved across species, suggesting a conserved function. The p.V118M is located in the DNA binding domain of the NR2E3 protein (UniProtKB/Swiss-Prot Q9Y5 × 4/ www/ebi.ac.uk/swissprot/ provided in the public domain by the European Bioinformatics Institute, Heidelberg, Germany). It may therefore affect the efficiency of DNA binding, but functional studies are warranted to confirm this property. A nearby mutation, p.R104Q in the DBD, had been found to be causative of a mild form of ESCS in concert with the p.R334G mutation in the ligand-binding domain (LBD) in NR2E3. 46 Therefore, mutations near the terminus of the DBD in NR2E3 may impair the binding efficiency of the protein but the impact on the pathogenesis of ESCS is not decisive. Another variant (p.E121K) flanking the p.V118M was also found to be causative of the recessive-inherited ESCS 40 ; but it was found as a common polymorphism in the Chinese individuals in our present study, suggesting the mutations located around this region have milder pathogenicity than that of the p.G56R. Notably, unlike p.G56R, which was found in two ADRP patients, p.V118M was found in two SRP and one patient with unknown inheritance. The disease was diagnosed in the three patients when they were in their middle or late age. They had fundus changes typical of RP and depressed or indistinguishable waveform elicited in electroretinography (data not shown). Such phenotypic features are different from ESCS. These findings may suggest that mutations located at the terminus of the DBD can also result in RP. However, as the patients' phenotypes are not inherited in a monogenic dominant pattern, it is likely that the p.V118M mutation contributes only partially to the RP of these patients. However, we do not have further evidence to exclude it as a de novo mutation. Meanwhile, our screening of another three RP genes, NRL, RP1, and RHO, in the three patients revealed no mutation. It is possible that mutations in as yet unidentified RP genes are involved in the genetic pathogenesis of RP in these patients. 
Therefore, NR2E3 mutations are responsible for 2.9% (5/172; 95% confidence interval [CI], 1.3%–6.7%) of overall RP in the Chinese according to this study, comparable to the contributions of RHO (2%) and RP1 (1%). The latter two genes, especially RHO, however, account for a far higher proportion of RP in Caucasians. 7,19  
In the NRL gene, six novel variants were detected. So far, at least 10 reported NRL mutations (p.S50T, p.S50P, p.S50L, p.P51L, p.P51S, p.P51T, p.P67S, p.A76V, p.G122E, and p.L235F) have been implicated in different subtypes of RP. 3537,44,4749 Six of these mutations affect residues 50 or 51, which are located in one of the two highly conserved regions of the transactivation domains of NRL, 44 located at residues 3 to 27 and 41 to 54, respectively. They could thus be mutation hotspots. These amino acid residues can be important structural or functional domains of the protein. In our present study, four (p.G33R, p.P35P, p.T36T and p.S38P) of the six NRL variants were located just between the two transactivation domains. However, they were detected only in control subjects, suggesting that mutations within this region of the minimal transactivation domain of NRL are nonpathogenic. The two synonymous changes detected in RP patients, p.T42T and p.R150R, are located on the transactivation domain and the extended homology domain, respectively. 50 They do not cause amino acid substitution. Since all known RP-causing mutations in NRL are either missense or nonsense changes, 50 these two variants are less likely to be disease-causing. Therefore, the NRL makes no contribution to RP risks in the Chinese population according to this study. 
In summary, among 172 Chinese RP patients and 360 control subjects, we found two NR2E3 mutations: the novel p.V118M and the reported p.G56R. Accordingly, NR2E3 mutations contribute to approximately 2.9% (5/172; 95% CI, 1.3–6.7%) of overall RP cases in Chinese, more than in Caucasians. By contrast, no disease-causing mutation was found in NRL. Thus, like RHO and RP1, the mutation profiles of NR2E3 and NRL are distinctively different between Caucasian and Chinese populations. Besides, the NR2E3 p.E121K variant, which has been shown to cause ESCS in Caucasians, is presented as a common SNP in Chinese, showing that other genetic or environmental factors are involved in the pathogenesis of ESCS caused by p.E121K. 
Footnotes
 Supported by the Chinese University of Hong Kong and the Lim Por Yen Eye Foundation Endowment Fund.
Footnotes
 Disclosure: Y. Yang, None; X. Zhang, None; L.J. Chen, None; S.W.Y. Chiang, None; P.O.S. Tam, None; T.Y.Y. Lai, None; C.K.M. Chan, None; N. Wang, None; D.S.C. Lam, None; C.P. Pang, None
The authors thank all the participants in the study. 
References
Berson EL Rosner B Sandberg MA . A randomized trial of vitamin A and vitamin E supplementation for retinitis pigmentosa. Arch Ophthalmol. 1993;111:761–772. [CrossRef] [PubMed]
Boughman JA Conneally PM Nance WE . Population genetic studies of retinitis pigmentosa. Am J Hum Genet. 1980;32:223–235. [PubMed]
Bunker CH Berson EL Bromley WC Hayes RP Roderick TH . Prevalence of retinitis pigmentosa in Maine. Am J Ophthalmol. 1984;97:357–365. [CrossRef] [PubMed]
Grondahl J . Estimation of prognosis and prevalence of retinitis pigmentosa and Usher syndrome in Norway. Clin Genet. 1987;31:255–264. [CrossRef] [PubMed]
Jay M . On the heredity of retinitis pigmentosa. Br J Ophthalmol. 1982;66:405–416. [CrossRef] [PubMed]
Puech B Kostrubiec B Hache JC Francois P . Epidemiology and prevalence of hereditary retinal dystrophies in the Northern France (in French). J Fr Ophtalmol. 1991;14:153–164. [PubMed]
Rivolta C Sharon D DeAngelis MM Dryja TP . Retinitis pigmentosa and allied diseases: numerous diseases, genes, and inheritance patterns. Hum Mol Genet. 2002;11:1219–1227. [CrossRef] [PubMed]
Guillonneau X Piriev NI Danciger M . A nonsense mutation in a novel gene is associated with retinitis pigmentosa in a family linked to the RP1 locus. Hum Mol Genet. 1999;8:1541–1546. [CrossRef] [PubMed]
Wang DY Chan WM Tam PO . Gene mutations in retinitis pigmentosa and their clinical implications. Clin Chim Acta. 2005;351:5–16. [CrossRef] [PubMed]
Berson EL Grimsby JL Adams SM . Clinical features and mutations in patients with dominant retinitis pigmentosa-1 (RP1). Invest Ophthalmol Vis Sci. 2001;42:2217–2224. [PubMed]
Bunge S Wedemann H David D . Molecular analysis and genetic mapping of the rhodopsin gene in families with autosomal dominant retinitis pigmentosa. Genomics. 1993;17:230–233. [CrossRef] [PubMed]
Dryja TP McEvoy JA McGee TL Berson EL . Novel rhodopsin mutations Gly114Val and Gln184Pro in dominant retinitis pigmentosa. Invest Ophthalmol Vis Sci. 2000;41:3124–3127. [PubMed]
Hartong DT Berson EL Dryja TP . Retinitis pigmentosa. Lancet. 2006;368:1795–1809. [CrossRef] [PubMed]
Khaliq S Abid A Ismail M . Novel association of RP1 gene mutations with autosomal recessive retinitis pigmentosa. J Med Genet. 2005;42:436–438. [CrossRef] [PubMed]
Kumaramanickavel G Maw M Denton MJ . Missense rhodopsin mutation in a family with recessive RP. Nat Genet. 1994;8:10–11. [CrossRef] [PubMed]
Riazuddin SA Zulfiqar F Zhang Q . Autosomal recessive retinitis pigmentosa is associated with mutations in RP1 in three consanguineous Pakistani families. Invest Ophthalmol Vis Sci. 2005;46:2264–2270. [CrossRef] [PubMed]
Rosenfeld PJ Cowley GS McGee TL Sandberg MA Berson EL Dryja TP . A null mutation in the rhodopsin gene causes rod photoreceptor dysfunction and autosomal recessive retinitis pigmentosa. Nat Genet. 1992;1:209–213. [CrossRef] [PubMed]
Sohocki MM Daiger SP Bowne SJ . Prevalence of mutations causing retinitis pigmentosa and other inherited retinopathies. Hum Mutat. 2001;17:42–51. [CrossRef] [PubMed]
Sullivan LS Bowne SJ Birch DG . Prevalence of disease-causing mutations in families with autosomal dominant retinitis pigmentosa: a screen of known genes in 200 families. Invest Ophthalmol Vis Sci. 2006;47:3052–3064. [CrossRef] [PubMed]
Baum L Chan WM Yeung KY Lam DS Kwok AK Pang CP . RP1 in Chinese: eight novel variants and evidence that truncation of the extreme C-terminal does not cause retinitis pigmentosa. Hum Mutat. 2001;17:436. [CrossRef] [PubMed]
Chan WM Yeung KY Pang CP . Rhodopsin mutations in Chinese patients with retinitis pigmentosa. Br J Ophthalmol. 2001;85:1046–1048. [CrossRef] [PubMed]
Chiang SW Wang DY Chan WM . A novel missense RP1 mutation in retinitis pigmentosa. Eye. 2006;20:602–605. [CrossRef] [PubMed]
Chen J Rattner A Nathans J . The rod photoreceptor-specific nuclear receptor Nr2e3 represses transcription of multiple cone-specific genes. J Neurosci. 2005;25:118–129. [CrossRef] [PubMed]
Peng GH Ahmad O Ahmad F Liu J Chen S . The photoreceptor-specific nuclear receptor Nr2e3 interacts with Crx and exerts opposing effects on the transcription of rod versus cone genes. Hum Mol Genet. 2005;14:747–764. [CrossRef] [PubMed]
Mears AJ Kondo M Swain PK . Nrl is required for rod photoreceptor development. Nat Genet. 2001;29:447–452. [CrossRef] [PubMed]
Oh EC Khan N Novelli E Khanna H Strettoi E Swaroop A . Transformation of cone precursors to functional rod photoreceptors by bZIP transcription factor NRL. Proc Natl Acad Sci U S A. 2007;104:1679–1684. [CrossRef] [PubMed]
Oh EC Cheng H Hao H Jia L Khan NW Swaroop A . Rod differentiation factor NRL activates the expression of nuclear receptor NR2E3 to suppress the development of cone photoreceptors. Brain Res. 2008;1236:16–29. [CrossRef] [PubMed]
Cheng H Khanna H Oh EC Hicks D Mitton KP Swaroop A . Photoreceptor-specific nuclear receptor NR2E3 functions as a transcriptional activator in rod photoreceptors. Hum Mol Genet. 2004;13:1563–1575. [CrossRef] [PubMed]
Cheng H Aleman TS Cideciyan AV Khanna R Jacobson SG Swaroop A . In vivo function of the orphan nuclear receptor NR2E3 in establishing photoreceptor identity during mammalian retinal development. Hum Mol Genet. 2006;15:2588–2602. [CrossRef] [PubMed]
Corbo JC Cepko CL . A hybrid photoreceptor expressing both rod and cone genes in a mouse model of enhanced S-cone syndrome. PLoS Genet. 2005;1:e11. [CrossRef] [PubMed]
Gire AI Sullivan LS Bowne SJ . The Gly56Arg mutation in NR2E3 accounts for 1-2% of autosomal dominant retinitis pigmentosa. Mol Vis. 2007;13:1970–1975. [PubMed]
Schorderet DF Escher P . NR2E3 mutations in enhanced S-cone sensitivity syndrome (ESCS), Goldmann-Favre syndrome (GFS), clumped pigmentary retinal degeneration (CPRD), and retinitis pigmentosa (RP). Hum Mutat. 2009;30(11):1475–1485. [CrossRef] [PubMed]
Coppieters F Leroy BP Beysen D . Recurrent mutation in the first zinc finger of the orphan nuclear receptor NR2E3 causes autosomal dominant retinitis pigmentosa. Am J Hum Genet. 2007;81:147–157. [CrossRef] [PubMed]
Escher P Gouras P Roduit R . Mutations in NR2E3 can cause dominant or recessive retinal degenerations in the same family. Hum Mutat. 2009;30:342–351. [CrossRef] [PubMed]
Bessant DA Holder GE Fitzke FW Payne AM Bhattacharya SS Bird AC . Phenotype of retinitis pigmentosa associated with the Ser50Thr mutation in the NRL gene. Arch Ophthalmol. 2003;121:793–802. [CrossRef] [PubMed]
Martinez-Gimeno M Maseras M Baiget M . Mutations P51U and G122E in retinal transcription factor NRL associated with autosomal dominant and sporadic retinitis pigmentosa. Hum Mutat. 2001;17:520. [CrossRef] [PubMed]
Nishiguchi KM Friedman JS Sandberg MA Swaroop A Berson EL Dryja TP . Recessive NRL mutations in patients with clumped pigmentary retinal degeneration and relative preservation of blue cone function. Proc Natl Acad Sci U S A. 2004;101:17819–17824. [CrossRef] [PubMed]
Wright AF Reddick AC Schwartz SB . Mutation analysis of NR2E3 and NRL genes in enhanced S cone syndrome. Hum Mutat. 2004;24:439. [CrossRef] [PubMed]
Hubbard T Barker D Birney E . The Ensembl genome database project. Nucleic Acids Res. 2002;30:38–41 [CrossRef] [PubMed]
Haider NB Jacobson SG Cideciyan AV . Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nat Genet. 2000;24:127–131. [CrossRef] [PubMed]
Notredame C Higgins DG Heringa J . T-Coffee: a novel method for fast and accurate multiple sequence alignment. J Mol Biol. 2000;362:205–217. [CrossRef]
Sharon D Sandberg MA Caruso RC Berson EL Dryja TP . Shared mutations in NR2E3 in enhanced S-cone syndrome, Goldmann-Favre syndrome, and many cases of clumped pigmentary retinal degeneration. Arch Ophthalmol. 2003;121:1316–1323. [CrossRef] [PubMed]
Bernal S Solans T Gamundi MJ . Analysis of the involvement of the NR2E3 gene in autosomal recessive retinal dystrophies. Clin Genet. 2008;73:360–366. [CrossRef] [PubMed]
Bessant DA Payne AM Mitton KP . A mutation in NRL is associated with autosomal dominant retinitis pigmentosa. Nat Genet. 1999;21:355–356. [CrossRef] [PubMed]
Fradot M Lorentz O Wurtz JM Sahel JA Leveillard T . The loss of transcriptional inhibition by the photoreceptor-cell specific nuclear receptor (NR2E3) is not a necessary cause of enhanced S-cone syndrome. Mol Vis. 2007;13:594–601. [PubMed]
Hayashi T Gekka T Goto-Omoto S Takeuchi T Kubo A Kitahara K . Novel NR2E3 mutations (R104Q, R334G) associated with a mild form of enhanced S-cone syndrome demonstrate compound heterozygosity. Ophthalmology. 2005;112:2115. [PubMed]
Bessant DA Payne AM Plant C Bird AC Swaroop A Bhattacharya SS . NRL S50T mutation and the importance of ‘founder effects’ in inherited retinal dystrophies. Eur J Hum Genet. 2000;8:783–787. [CrossRef] [PubMed]
DeAngelis MM Grimsby JL Sandberg MA Berson EL Dryja TP . Novel mutations in the NRL gene and associated clinical findings in patients with dominant retinitis pigmentosa. Arch Ophthalmol. 2002;120:369–375. [CrossRef] [PubMed]
Ziviello C Simonelli F Testa F . Molecular genetics of autosomal dominant retinitis pigmentosa (ADRP): a comprehensive study of 43 Italian families. J Med Genet. 2005;42:e47. [CrossRef] [PubMed]
Kanda A Friedman JS Nishiguchi KM Swaroop A . Retinopathy mutations in the bZIP protein NRL alter phosphorylation and transcriptional activity. Hum Mutat. 2007;28:589–598. [CrossRef] [PubMed]
Figure 1.
 
Multiple sequence alignment for NR2E3 (partially). Sequences of human (Homo sapiens NP_055064.1), chimp (Pan troglodytes XP_001175020.1 ), dog (Canis familiaris XP_544754.2), mouse (Mus musculus NP_038736.1), chicken (Gallus gallus NP_989925.1), and frog (Xenopus tropicalis NP_001090633.1).
Figure 1.
 
Multiple sequence alignment for NR2E3 (partially). Sequences of human (Homo sapiens NP_055064.1), chimp (Pan troglodytes XP_001175020.1 ), dog (Canis familiaris XP_544754.2), mouse (Mus musculus NP_038736.1), chicken (Gallus gallus NP_989925.1), and frog (Xenopus tropicalis NP_001090633.1).
Figure 2.
 
Fundus photo of the subject HKRP466, a carrier of the NR2E3 p.G56R mutation.
Figure 2.
 
Fundus photo of the subject HKRP466, a carrier of the NR2E3 p.G56R mutation.
Table 1.
 
Primer Sequences and Thermal Cycling Conditions for NR2E3 and NRL Screening
Table 1.
 
Primer Sequences and Thermal Cycling Conditions for NR2E3 and NRL Screening
Primer Primer Sequence (5′→3′) PCR Product Size (bp) PCR Conditions
NR2E3 1-F TGTGGAGACAGTAAAGATTAAGAGG 461 2.0 mM MgCl2; 56°C
NR2E3 1-R AGTTGTTCTGGCTCCTTCCAT
NR2E3 2/3-F CGTGGGTTCGTTCAAATGC 670 1.5 mM MgCl2; 56°C
NR2E3 3-R CAGTGTTGGACTCCATGCTG
NR2E3 4/5-F GGCTGAAGAAGTGCCTGCA 756 1.5 mM MgCl2; 56°C
NR2E3 5-R CCCTGTCTGGTTGACTCGAGT
NR2E3 6/7/8-F AGGACAGCACTTCCATTCCTTGG 935 1.5 mM MgCl2; 56°C
NR2E3 8R TTGTGCTGTCTAATCAGTGAGCTC
NR2E3 9F AAATTCCTCCTGACCCACTCTG 365 2.0 mM MgCl2; 56°C
NR2E3 9R ACACCTACGAGGAATTGCTGG
NR2E3 P1F TTCAAGATGTGGCATGAAATGG 286 2.0 mM MgCl2; 56°C
NR2E3 P1R AACTCTGTCTGAACTCAGGAGCTG
NRL 1F CTGGCTTTCCCAAACTCTTG 664 1.5 mM MgCl2; 62°C
NRL 1R CTTTCAAGGGACCTTCTCCC
NRL 2F GAAACAGACTGCGTGGAAGG 567 1.5 mM MgCl2; 62°C TD(−0.2)
NRL 2R TAACGATGCAGAGAACCGTG 30 cycles + 56°C 10 cycles
Table 2.
 
Sequence Variations Detected in the NR2E3 and NRL Genes among Chinese RP Patients and Control Subjects
Table 2.
 
Sequence Variations Detected in the NR2E3 and NRL Genes among Chinese RP Patients and Control Subjects
Location Nucleotide Change Residual Change Description Genotype Frequency*
Patients (n = 172) Controls (n = 180)
NR2E3 variants†
    Intron 1 c.119-47C>T Novel 0/3/169 2/4/174‡
    Intron 1 c.119-28T>C rs2742318 1/6/164 2/13/165‡
    Intron 1 c.119-28_119-13del Novel 0/1/171 0/0/180
    Exon 2 c.166G>A p.G56R Reported 33 0/2/170 0/0/180
    Exon 2 c.183C>T p.1611 Novel 0/0/172 0/1/179
    Intron 2 c.245+75G>A Novel 0/1/171 0/0/180
    Intron 3 c.349+8G>A Novel 1/8/163 0/6/174
    Exon 4 c.352G>A p.V118M Novel 0/3/169 0/0/180
    Exon 4 c.361G>A p.E121K Reported 40 1/22/149 4/14/162‡
    Exon 4 c.419A>G p.E140G rs1805020 2/37/133 4/37/139
    Exon 4 c.488T>C p.M163T rs1805021 2/40/130 4/34/142
    Exon 6 c.829C>T p.L277L Novel 0/1/171 0/0/180
    Exon 6 c.843C>T p.P281P Novel 0/1/171 0/0/180
    Exon 6 c.899C>T p.T300M Novel 0/0/172 0/1/179
    Exon 6 c.904 G>A p.V3021 rs1805025 0/13/159 0/6/174
    Exon 7 c.963 C>T p.A321A Novel 0/5/167 0/4/176
    Intron 8 c.1101-87C>T Novel 0/0/172 0/1/179
    Intron 8 c.1101-47G>A Novel 0/0/172 0/1/179
    Exon 9 c.1124C>T p.P375L Novel 0/0/172 0/1/179
    3′UTR c.1230+53C>T Novel 0/1/171 0/0/180
NRL variants†
    Exon 2 c.97G>C p.G33R Novel 0/0/172 0/1/179
    Exon 2 c.105T>C p.P35P Novel 0/0/172 0/1/179
    Exon 2 c.108A>C p.T36T Novel 0/0/172 0/1/179
    Exon 2 c.112T>C p.S38P Novel 0/0/172 0/1/179
    Exon 2 c.126A>G p.T42T Novel 0/1/171 0/0/180
    Exon 3 c.450G>C p.R150R Novel 0/2/170 0/0/180
Table 3.
 
Demographic and Clinical Features of Carriers of NR2E3 Mutations
Table 3.
 
Demographic and Clinical Features of Carriers of NR2E3 Mutations
Mutation Subject Sex Age at Diagnosis* Inheritance Pattern
p.G56R HKRP397 F 54 ADRP
p.G56R HKRP466 F 56 ADRP
p.V118M HKRP442 F 51 Unknown
p.V118M HKRP195 F 52 SRP
p.V118M HKRP210 M 71 SRP
Table 4.
 
Evaluation of Pathogenic Potential of Missense Mutations of NR2E3
Table 4.
 
Evaluation of Pathogenic Potential of Missense Mutations of NR2E3
Location Functional Domain Residual Change Cases (n = 172) Controls PolyPhen SIFT Grantham Score
Hong Kong Beijing Prediction PSIC Score Prediction Score
Exon 2 DBD p.G56R* 2 0/180 Probably damaging 2.844 Intolerant 0.02 125
Exon 4 DBD p.V118M 3 0/180 0/180 Probably damaging 2.163 Intolerant 0.00 21
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×