cGMP Phosphodiesterase-α Mutation Causes Progressive Retinal Atrophy in the Cardigan Welsh Corgi Dog

Abstract

purpose. To screen the α-subunit of cyclic guanosine monophosphate (cGMP) phosphodiesterase (PDE6A) as a potential candidate gene for progressive retinal atrophy (PRA) in the Cardigan Welsh corgi dog.

methods. Single-strand conformation polymorphism (SSCP) analysis was used to screen short introns of the canine PDE6A gene for informative polymorphisms in members of an extended pedigree of PRA-affected Cardigan Welsh corgis. After initial demonstration of linkage of a polymorphism in the PDE6A gene with the disease locus, the complete coding region of the PDE6A gene of a PRA-affected Cardigan Welsh corgi was cloned in overlapping fragments and sequenced. SSCP-based and direct DNA sequencing tests were developed to detect the presence of a PDE6A gene mutation that segregated with disease status in the extended pedigree of PRA-affected Cardigan Welsh corgis. Genomic DNA sequencing was developed as a diagnostic test to establish the genotype of Cardigan Welsh corgis in the pet population.

results. A polymorphism within intron 18 of the canine PDE6A gene was invariably present in the homozygous state in PRA-affected Cardigan Welsh corgis. The entire PDE6A gene was cloned from one PRA-affected dog and the gene structure and intron sizes established and compared with those of an unaffected animal. Intron sizes were identical in affected and normal dogs. Sequencing of exons and splice junctions in the affected animal revealed a 1-bp deletion in codon 616. Analysis of PRA-affected and obligate carrier Cardigan Welsh corgis showed that this mutation cosegregated with disease status.

conclusions. A single base deletion at codon 616 in the PDE6A gene cosegregated with PRA status with zero discordance in Cardigan Welsh corgis with PRA. A lod score of 4.816 with a recombination fraction (θ) of zero strongly suggests that this mutation is responsible for PRA in the breed. The mutation is predicted to lead to a frame shift resulting in a string of 28 altered codons followed by a premature stop codon. The authors suggest that this type of PRA be given the name rod–cone dysplasia 3 (rcd3).

Gene mutations causing autosomal recessive retinitis pigmentosa (ARRP) in humans have been reported in opsin, ¹ theα - ² and β- ³ subunits of cyclic guanosine monophosphate (cGMP) phosphodiesterase, the α- subunit of cGMP-gated channel, ⁴ RPE65, ⁵ adenosine triphosphate (ATP)-binding cassette transferase protein, ^{6 7} tubby-like protein 1 (TULP1), ⁸ and cellular retinaldehyde-binding protein. ⁹ The analogous group of conditions in the dog are the progressive retinal atrophies (PRAs) and are known to occur in several breeds of dog (see ^{Ref. 10} for a review). Despite investigating genes known to cause similar retinal dystrophies in other species, the only causal gene mutation identified before this report is that which causes rod–cone dysplasia type 1 (rcd1) in the Irish setter breed. Rcd1 is caused by an amber mutation in theβ -subunit of the cGMP phosphodiesterase gene (PDE6B). ^{11 12 13} Mutations in the homologous gene have been identified in the retinal degeneration (rd) mouse, ^{14 15} and a subset of autosomal recessive retinitis pigmentosa patients. ^{3 16 17 18} Rcd1 is characterized by the absence of cGMP-phosphodiesterase activity, leading to a 10-fold increase in cGMP levels. ¹⁹ This results in arrested development of photoreceptors followed by a progressive rod-led photoreceptor degeneration. ²⁰ PRA in the collie is characterized by similar biochemical and histopathologic changes. ^{21 22 23} However, breeding studies have shown the two forms of PRA to be nonallelic, ²⁴ leading to the designation of the form in the collie as rod–cone dysplasia type 2 (rcd2). Both rcd1 and rcd2 are early-onset forms of PRA. 

PRA in the Cardigan Welsh corgi has a similar early onset leading to blindness in the young adult dog and, similar to most forms of canine PRA, is inherited in an autosomal recessive manner. PRA in this breed was first recorded in the veterinary literature in 1972 ²⁵ and has recently undergone a resurgence, with cases occurring in The Netherlands, New Zealand, and the United States. The affected lines in all three countries can be traced back to stock imported from the United Kingdom. Detailed electrophysiological, histopathologic, and biochemical analysis of PRA-affected Cardigan Welsh corgis has not yet been performed. 

We report here that PRA in the Cardigan Welsh corgi is caused by a 1-bp deletion in codon 616 of PDE6A. We predict that the histopathogenesis of this form of PRA is similar to that resulting from the amber mutation in PDE6B in rcd1, and if this proves to be the case, we propose that the condition in the Cardigan Welsh corgi be designated rod–cone dysplasia type 3 (rcd3). 

PRA in the Cardigan Welsh corgi is only the second form of canine PRA for which the causal gene mutation has been identified and represents the only naturally occurring animal model of ARRP due to a PDE6A mutation. 

Methods

Dogs

Genomic DNA was extracted from blood samples obtained from dogs within pedigrees of Cardigan Welsh corgis in which PRA was segregating and also from unaffected breeding lines. The diagnosis of PRA was made by veterinary ophthalmologists on the basis of clinical history and ophthalmoscopic signs. A pedigree showing the relationship between affected animals is shown in Figure 4 . Treatment of animals conformed to the ARVO Statement on the Use of Animals in Ophthalmic and Vision Research. 

Single-Strand Conformation Polymorphism Analysis of Presumptive Intron 18 of the Canine PDE6A Gene

Using information about the intron sizes and position of the human alpha PDE gene (kindly supplied by Steven Pittler before publication) a primer pair (sense 5′-GTGATCTCTCAGCCATCACC-3′ and antisense 5′-GATTCTGCTGCAGCACTGTG-3′) was designed from the canine cDNA sequence ^{26 27 28} to amplify the presumptive intron 18 of the canine gene by polymerase chain reaction (PCR). The PCR product was found to be a suitable length for single-strand conformation polymorphism (SSCP). PCR-SSCP was performed by the inclusion of 2 μCi [α-³²P]dATP (Amersham Life Science, Amersham, UK) in a 50-μl PCR reaction. After thermal cycling, 2 μl of the resultant product was placed into 10 μl SSCP loading buffer (95% deionized formamide; 10 mM NaOH; 0.05% bromphenol blue; 0.05% xylene cyanol). The samples were denatured by heating to 95°C for 2 minutes and placing on ice for 15 minutes and electrophoresis performed on a 0.5× MDE-hydrolink polyacrylamide gel (Hoefer, Newcastle-under-Lyme, UK), with a running buffer of 0.6× TBE, at 0.12 W/cm for 14 hours at room temperature. The gels were dried and autoradiographed (X-OMAT film; Eastman Kodak, Rochester, NY). 

Sequencing of the Coding Region of the Canine PDE6A Gene

Using the published canine cDNA sequence ^{26 27 28} with predicted intron positions from the human gene, 21 oligonucleotide primer pairs were designed that would amplify the entire coding region and introns of the canine gene in overlapping fragments (Table 1) .The resultant PCR products were used to estimate the sizes of the introns in the canine PDE6A gene. Sequencing to obtain the entire sequence of the coding region and intron–exon boundaries was performed. Initially, PCR products were cloned using the TA cloning kit (Invitrogen, NV Leek, Groningen, The Netherlands) and at least two independently derived clones from each region were sequenced by double-stranded sequencing using a Thermo-Sequenase core sequencing kit (Vistra DNA Systems; Amersham) with a sequencing primer labeled with Texas red (Amersham) and run on a Vistra 725 DNA sequencer (Vistra DNA Systems; Amersham). 

Linkage Analysis

Two-point lod scores were calculated for segregation of PRA and an exon 15 1-bp deletion in two-generation families (phase unknown) represented in the pedigree. ²⁹ MLINK from the LINKAGE program package (Human Genome Mapping Project, Medical Research Council, UK) was used for these calculations. ³⁰  

The allele frequencies within each group of blood samples were used to perform a simple binomial analysis of the probability of homozygosity for a given allele in affected animals, given independent assortment of trait and allele. Contingent probabilities for allele frequencies in the carrier dogs were not included. Therefore, the real probability of independence (no linkage) is lower than the figure quoted in all cases. 

Sequencing of a PCR Product Spanning the Site of the Codon 616 1-bp Deletion

PCR amplification of a genomic fragment containing part of intron 14 and the mutation site in exon 15 was performed using sense primer 5′-TCATTCCATCGCCGACTC-3′ (primer positioned ^–81–^–64 from intron–exon boundary) and antisense primer 5′-CCTCATCTCGCAGCAACGTT-3′ (corresponds to first nucleotide of intron 15 plus nucleotides 2019–2001). Initially, a radioactively labeled PCR was carried out using 50 ng genomic DNA in the presence of 2 μCi ³²P-dATP and SSCP analysis performed as before. Subsequently, an unlabeled PCR reaction was used, and 2 μl of the reaction product was sequenced directly by a Taq-based method (Thermo-Sequenase, Amersham) as before, using a Texas red–labeled oligonucleotide 5′-GGTGTCTTTCCAAGATGGAG-3′ (corresponds to nucleotide numbers 1984–1965) as primer. 

Results

Screening of Intron 18 of PDE6A for Polymorphisms by SSCP

SSCP revealed that intron 18 of PDE6A was polymorphic in the Cardigan Welsh corgis examined, including dogs with PRA (Fig. 1) . Two alleles (which we designated B and b) were present. Sequencing the PCR products showed that B differed from b at four positions within the intron (55 C > T, 65 T > C, 88 A > C, and 121 G>C). It was noted that all the PRA-affected dogs were homozygous for one of the alleles (b) and all the obligate carrier dogs had at least one copy of the same allele. Binomial analysis of the segregation of alleles in a small group of dogs (3 affected, 4 obligate carrier, and 11 ophthalmoscopically normal) showed P < 0.063 of the intron polymorphism assorting independently to PRA, although bb homozygotes were found among ophthalmoscopically normal and PRA-affected dogs (Fig. 1) . This suggested that the PRA-causing mutation could have occurred on the b chromosome genetic background, making the locus worthy of further investigation. 

Sequencing of the Coding Region of the PDE6A Gene in PRA-Affected Cardigan Welsh Corgis

The entire PDE6A gene from a PRA-affected Cardigan Welsh corgi was amplified by PCR and all exons and intron–exon junctions sequenced. The canine gene spans approximately 53 kb of genomic DNA and the intron–exon structure of the gene was found to be the same as for the human orthologue (S. Pittler 1997, personal communication). The gene structure, size of introns, and PCR strategy used are shown in Table 1 . Subsequent amplification of the equivalent fragments from an ophthalmoscopically normal dog unrelated to the known PRA-affected dogs, showed that no gross rearrangements, insertions, or deletions to the gene that were detectable by agarose gel electrophoresis had occurred (data not shown). Sequencing of the gene from the PRA-affected animal showed that the cDNA sequence differed from each of the previously published sequences for canine PDE6A (GenBank accession numbers Z68340, U52868, and Y13282) at one or more of seven positions as shown in Table 2 (EMBL accession numbers AJ233677–AJ233693 give exonic and partial intronic sequences). In addition, the sequencing of exon 15 revealed the presence of a 1-bp adenine deletion at nucleotide 1939–1940 (numbering of Z68340), codon 616, causing a frame shift (Fig. 2) . This causes premature termination of translation at a stop codon at position 644. 

Using SSCP, all affected dogs for which we had DNA samples were shown to be homozygous for the mutation (including dogs from The Netherlands and from the United States), and all the obligate carriers were heterozygous (example, Fig. 3 ). All these dogs could be fitted to a large pedigree (Fig. 4) , originating with a single UK-bred dog. None of the other clinically normal adult dogs within the pedigree (or outside it) were homozygous for the mutation. 

The SSCP data for the mutation in exon 15 were analyzed to test the strength of evidence of linkage between the PDE6A mutation and the disease allele. Eight PRA-affected dogs and 10 obligate carriers could be grouped into four incomplete two-generation families (2 offspring in these families were known to be carriers because they were parents of affected animals in succeeding generations), allowing calculation of a two-point lod score (phase unknown). This provided Z(θ)max = 4.816 for θ = 0, with a support interval showing θ is less than 0.15. (θ is the recombination fraction, Z(θ) the lod for that fraction). 

To include in the analysis of the exon 15 mutation SSCP results for samples from dogs that were not closely related, we also conducted a binomial analysis of the data from exon 15 for all PRA-affected and obligate carrier animals, based on the allele frequencies observed in a sample of 41 dogs, including 16 normal animals, 12 carriers, and 13 PRA-affected animals. The probability of complete phase conservation between disease and PDE6A allele status occurring by chance in this sample, if there is no linkage between disease and PDE6A locus, is P < 0.000002. 

We identified a microsatellite at the 3′ end of intron 14 of the gene, ending only 18 bases upstream from the deletion site and 11 bases from the splice acceptor site. In a survey of 43 Cardigan Welsh corgi dogs, direct sequencing of PCR amplification products spanning the microsatellite revealed 6 alleles of the microsatellite: (GT)¹⁰GCGTGTGC(GT)¹²; (GT)¹⁰GCGTGTGC(GT)¹¹; (GT)¹⁰GCATGTGC(GT)¹¹; (GT)¹⁰AT(GT)¹⁴; (GT)¹⁰GAGTGTGA(GT)¹¹; (GT)²⁵. The adenine deletion at nucleotide 1939–1940 was invariably associated with the first of these alleles, which was the commonest allele in the population sample (70% of alleles), and 2 bp longer than the other alleles. Because the sample was collected during investigations of PRA-affected animals and their relatives, the allele frequency found is likely to be biased toward the PRA-associated allele. Observed heterozygosity in this sample was 44.2%. Subsequent observations from more than 200 other Cardigan Welsh corgi dogs did not reveal any other alleles of the microsatellite. 

Testing of Further Pet Cardigan Welsh Corgis for the Presence of the Adenine Deletion at Position 1939–1940

Recently, we have tested Cardigan Welsh corgis from the general pet populations of a number of different countries for the presence of the adenine deletion at position 1939–1940. Genomic DNA was amplified by PCR across the mutation site and directly sequenced (Fig. 5) . The animals tested were self-selected by their owners. Therefore, there may be biases operating either toward or away from testing of breeding lines already suspected by owners of carrying PRA. Of 31 ophthalmoscopically normal animals tested in this phase of the work, 4 have been carriers of the mutation (frequency of the mutant allele, 6.5%). We also used this test to reanalyze our research pedigree samples and found complete concordance with the exon 15 SSCP findings. In the research as a whole, Cardigan Welsh corgis carrying the mutation have been found in the dog populations of the United Kingdom, The Netherlands, the United States, Germany, and New Zealand. 

Discussion

Canine PRA represents a genetically diverse group of retinal dystrophies with strong similarities to retinitis pigmentosa. Before this publication, the only form of PRA characterized at the molecular level was rod–cone dysplasia type 1 (rcd1) in the Irish setter. Rcd1 is caused by a point mutation in PDE6B resulting in the introduction of a premature stop codon. This report demonstrates that PRA in the Cardigan Welsh corgi is also caused by a mutation of a subunit of cGMP phosphodiesterase, but this time the α-subunit. All dogs that we have observed carrying the mutation have now been found to be in direct line of descent from the dog indicated with an arrow in the pedigree (Fig. 4) . This dog was a show champion born in the late 1950s. The disease was first recognized in the United Kingdom and in Australia in the mid 1960s. During the next few years, strenuous efforts were made by breed societies to avoid breeding from lines in which PRA occurred. This may be why serious recrudescence of the disease did not occur until the 1990s. 

The mutation identified here is predicted to shorten the translated protein by 218 amino acids. If translated, the resultant protein would be missing part of the catalytic domain ³¹ and the C-terminal cysteine responsible for membrane binding. ³² Mutations in this gene have been described in families with ARRP, and the Cardigan Welsh corgi is the first recorded naturally occurring animal model of this form of retinitis pigmentosa. This makes the Cardigan Welsh corgi a potentially valuable model for studying retinal dystrophy due to PDE6A mutations and also as a model for treatments, such as the use of growth factors or gene therapy, that are intended to slow down or halt the retinal degeneration. 

There is only a limited clinical description of PRA in the Cardigan Welsh corgi. Keep ²⁵ reported that ophthalmoscopically the disease in this breed can generally be detected between 6 and 16 weeks of age. Affected animals are usually blind before 1 year, but some retain limited central vision to 3 to 4 years of age. A similar variation in rate of vision loss was first reported in rcd1 by Parry ³³ in the 1950s and confirmed by Ray et al. ³⁴ once a DNA-based test for the mutation had been developed. 

We predict that this mutation results in a rod–cone dysplasia similar to that seen in rcd1. If this is the case, we propose it be given the name rod–cone dysplasia type 3 (rcd3). This distinguishes it from rcd1, the PDE6B nonsense mutation seen in Irish setters, and rcd2. PDE6A has been excluded as the rcd2 locus. ³⁵  

 Reprint requests: Simon M. Petersen–Jones, Department of Small Animal Clinical Sciences, Michigan State University, D-208 Veterinary Medical Center, East Lansing, MI 48824-1314.

 Supported by Wellcome Trust Veterinary Research Career Development Fellowship 041623/z (SMP–J).

 Submitted for publication October 27, 1998; revised February 2, 1999; accepted March 2, 1999.

 Proprietary interest category: N.

¹  Present address: Department of Small Animal Clinical Sciences, College of Veterinary Medicine, Michigan State University, East Lansing, Michigan.

 

Table 1.

 

Details of Strategy Used to Amplify Canine PDE6A, Establish Intron Sizes, and Sequence the Coding Region and Intron–Exon Boundaries

Gene Fragment	Sense Primer Sequence (5′–3′) (Numbering)*	Antisense Primer Sequence (5′–3′) (Numbering)*	PCR Conditions, ∥ (Annealing temp. °C)	Intron
								No.	Size
5′ UTR–exon 1	CCAGCTATAGACCTTCCCTG (24–43)	GGACAGCATCCTTGTGGACA (454–435)	ST (60)	n/a
Exon 1–exon 3	AATGGCATCGCAGAGCTAGC (400–419)	CGCCGAGTCTGAGAATTGTG (803–784)	LR1 (60)	1	6600bp
Exon 2–exon 3	CCTCACTGAGTACCAGACCA (597–616)	CGCCGAGTCTGAGAATTGTG (803–784)	ST (60)	2	742bp, ‡
Exon 2–exon 4	CCTCACTGAGTACCAGACCA (597–616)	CTTGGTCATGTCTAAGAGTC (945–926)	LR1 (56)	3	600bp
Exon 4–exon 5	GCCTTCCTCAACTGTGACAG (895–914)	GAGTCCTGGGACCAGAATAG (1015–996)	LR1 (60)	4	4700bp
Exon 5–exon 6	ATGTGTGGCCAGTCCTGATG (962–981)	TGTCTTCTTTGCCGTGTAGG (1078–1059)	ST (58)	5	650bp
Exon 6–exon 8	CAAGGTCATTGACTATATCC (1041–1060)	CCTGGAATGCAAAAAAGTCC (1206, †–1188)	LR1 (52)	6	7500bp
Exon 7–exon 8	ATCCACCTCCTGATCATTGG (1094–1113)	CCTGGAATGCAAAAAAGTCC (1206, †–1188)	LR1 (56)	7	3200bp
Exon 8–exon 9	TGCAACATCATGAATGCACC (1162–1181)	AGGGTCTCATCCATTTCATC (1349–1330)	ST (56)	8	2800bp
Exon 9–exon 10	TGGATGAGTCTGGATGGATG (1217–1236)	CATTGTCACACTTCACGTGG (1480–1461)	ST (56)	9	550bp
Exon 10–exon 11	GGCTGGTCCGTCTTAAATCC (1375–1394)	AGGATCTCAGCGAGTTCCTC (1565–1546)	ST (60)	10	1900bp
Exon 11–exon 12	CCAGAGAGGTGTATGGGAAG (1505–1524)	TTTCACCAGCTCCAGTTCGG (1653–1634)	ST (60)	11	214bp, ‡
Exon 12–exon 13	AGAGCTGCCAGATGCAGAGA (1572–1591)	AGCAAGGAGAACATGGTCTG (1817–1798)	ST (63)	12	950bp
Exon 13–exon 14	TGCGCTTCATGTACTCGCTG (1721–1740)	GTCAATGTCATGGCAGAAGG (1899–1880)	ST (58)	13	1500bp
Exon 14–exon 15	GCGATACTTCACAGACCTAG (1836–1855)	CCTCATCTCGCAGCAACGTT (2019, †–2001)	ST (58)	14	1400bp
Exon 15–exon 16	AGACACCACTTGGAGTTCGG (1978–1997)	TGCTGCCTGCGATTGAGGTT (2057–2038)	ST (63)	15	180bp, ‡
Intron 15–exon 17	TTCTCACATCTCTTCTACGG (in intron 15, § )	TCCGTGTCTGCTCCAGCATC (2215–2196)	ST (56)	16	417bp, ‡
Exon 15–exon 19	AGACACCACTTGGAGTTCGG (1978–1997)	GATTCTGCTGCAGCACTGTG (2362–2343)	LR3 (63)	17	11000bp
Exon 18–exon 19	GTGATCTCTCAGCCATCACC (2249–2268)	GATTCTGCTGCAGCACTGTG (2362–2343)	ST (63)	18	288bp, ‡
Exon 19–exon 20	ACTGGTTGCTGCCGAATTCT (2301–2320)	GACAAAGGTGCAAACAAAGT (2445–2426)	ST (55)	19	1500bp
Exon 20–exon 21	CCCAAGCTTCAAGTCGGCTT (2401–2420)	TGTCGTACTCATCGGCGAGC (2545–2526)	ST (60)	20	1500bp
Exon 21–3′ UTR	TCCCATGCTGGATGGGATCA (2481–2500)	AAGGGTGGTACCATTCGGTG (2718–2699)	ST (60)	21	1900bp

*  Numbering according to genebank accession number Z68340.

†  The 5′ nucleotide of these primers corresponds to the first nucleotide of the intron.

‡  Exact size of introns (remainder are sized from PCR product size).

§  The sense primer in intron 15 was positioned −32 to −13 nucleotides from the intron 15/exon 16 boundary.

∥  PCR conditions as follows: LR1, long-range PCR (Expand Long Template PCR System, Boehringer Mannheim, Lewes, UK) using manufacturer’s buffer 1 (final concentrations of dNTPs, primers, enzymes, and buffer as recommended by manufacturer); LR3 = long-range PCR (Expand Long Template PCR System, Boehringer Mannheim, Lewes, UK) using manufacturer’s buffer 3 (final concentration of dNTPs, primers, enzymes, and buffer as recommended by manufacturer); ST, standard PCR using Taq polymerase (Gibco BRL, Life Technologies, Paisley, UK), final concentrations: 20 mM Tris-HCl, pH 8.4; 50 mM KCl; 1.5 mM MgCl₂; 1% bovine serum albumin, 100μ M each of dATP, dCTP, dGTP, dTTP; 0.2 μM of each primer; 1 U Taq. Cycling conditions were as follows: Long-range PCR 94°C for 2 minutes, 10 cycles of 94°C for 10 seconds, then T°C anneal for 30 seconds, then 68°C for 5 minutes, followed by increasing extension time by 30 seconds every three cycles for 6 × 3 cycles. For standard PCR 94°C for 2 minutes, followed by 35 cycles of 94°C for 20 seconds, then T°C anneal for 30 seconds, then 72°C for 1 minute, with a final extension at 72°C for 10 minutes.

Figure 1.

 

SSCP analysis of a polymorphism in intron 18 of the canine PDE6A segregating in a group of PRA-affected and normal Cardigan Welsh corgi dogs (see the Methods section for the procedure used). All PRA-affected Cardigan Welsh corgi dogs were homozygous for the b allele, and all obligate carriers had at least one b allele. A: PRA-affected. All are homozygous for the b allele (bb). C: obligate PRA-carriers. All carriers had at least one b allele. N: ophthalmoscopically normal unrelated dog (BB). N* is an ophthalmoscopically normal dog that is homozygous for the same allele that is found in all the affected animals (bb).

Table 2.

 

Summary of Polymorphic Residues in PDE6A cDNA Sequence

	Position*
		91	192	625	791	931	1255	1920
Present study	G	C	T	T	C	A	C
Kylma et al. 27 (Z68340)	G	C	T	T	T	A	C
Wang et al. 26 (U52868)	G	C	C	C	T	T	C
Veske et al. 28 (Y13282)	T	T	T	C	C	A	T
Comment, †	5′ Leader	I > I	L > L	C > C	L > L	M > L	L > L

 Polymorphic residues between the canine PDE6A cDNA sequence established in the present study and the three previously reported cDNA sequences.

*  Numbering follows that of Kylma et al. ²⁷ (Z68340). We have sequenced the region from +26 to 2718 from an affected animal (coding region and parts of introns). This includes the whole protein coding region.

†  Amino acids encoded by our sequence and variants from it, at the polymorphic positions.

Figure 2.

 

Comparison of normal and mutant canine PDE6A cDNA sequence and translation in the region of the mutation responsible for PRA in the Cardigan Welsh corgi dog. The mutation is an adenine deletion at codon 616, nucleotide 1939–1940 (numbering according to Kylma et al.²⁷; EMBL submission number Z68340). The site of the deletion is highlighted (both possible A residues shown in bold), as is the sequence of the abnormal protein resulting from the frame shift. Vertical lines indicate position of exon–exon boundaries.

Figure 3.

 

SSCP analysis of part of intron 14 and exon 15 of canine PDE6A in PRA-affected, obligate carrier, and other ophthalmoscopically normal Cardigan Welsh corgis (see the Methods section for the procedure used). A: PRA-affected Cardigan Welsh corgi dogs. All five affected dogs have an identical SSCP pattern. N: ophthalmoscopically normal Cardigan Welsh corgi dogs from breeding lines reputed to be free of PRA. These two normal dogs have a different SSCP pattern compared with the PRA-affected dogs. C: obligate PRA-carrier Cardigan Welsh corgi dogs. The SSCP patterns for all obligate carriers are the result of a combination of the pattern for the PRA-affected dogs and the pattern for the ophthalmoscopically normal dogs. This shows that the carriers are heterozygous for the two SSCP-detectable alleles.

Figure 4.

 

A pedigree relating PRA-affected Cardigan Welsh corgi dogs from several parts of the world. The arrow points to a sire common to all lines with PRA. This dog was registered in the United Kingdom in the late 1950s. Open symbols represent dogs that are phenotypically normal, but of unknown genotype; open symbols with central spots represent dogs not examined; filled symbols represent PRA-affected dogs; and half-filled symbols PRA-carriers. Squares represent males, circles females.

Figure 5.

 

Direct sequencing of a PCR product spanning the site of the codon 616 adenine deletion in the PDE6A gene (see the Methods section for process used). The output from a DNA sequencer is shown. The sequence information spans the PRA-causing mutation site. The antisense strand is shown. The top sequence track is from a genotypically normal dog (Normal dog), the middle track from a PRA-affected Cardigan Welsh corgi dog (rcd-3 dog), and the bottom track from a PRA-carrier Cardigan Welsh corgi dog (Carrier dog). V’s indicate the region of the 1-bp deletion (normal, TTCT; PRA mutant, TCT). The sequence from the heterozygous PRA carrier is disrupted because of the 1-bp deletion in half of the PCR product. Part of a microsatellite can be seen at the right of the sequence tracks. The disruption of sequence in the heterozygous animal is most obvious in the sequence from the microsatellite.

The authors thank the Cardigan Welsh Corgi Breed Associations of the United Kingdom, the United States, and the Netherlands for their enthusiastic participation in this study; and Frans Stades for screening dogs in the Netherlands and collecting blood samples for this study.