HLA-B27 Subtypes and HLA Class II Alleles in Japanese Patients with Anterior Uveitis

Abstract

purpose. Some patients with anterior uveitis (AU) have ankylosing spondylitis (AS) and are HLA-B27 class I–positive. The purpose of this study was to investigate whether there are differences in HLA at the allele level among each group of patients with AU.

methods. Seventy-three patients with AU were studied. They were classified into three groups: 31 with AS-associated AU, 14 with HLA-B27–associated AU, and 28 with idiopathic AU. Three control groups without AU were used: 138 random subjects, 33 HLA-B27–positive healthy subjects, and 19 HLA-B27–positive patients with AS. DRB1 and DQB1 genotyping was performed using polymerase chain reaction (PCR)–single-strand conformation polymorphism (PCR-SSCP) and PCR–restriction fragment length polymorphism. HLA-B27 subtype was determined by PCR-SSCP.

results. There was no difference in the frequency of any class I antigen except HLA-B27 among the patients studied. The frequencies of HLA-DR12 in AS-associated AU and HLA-DR1 in HLA-B27–associated AU showed an increase. In HLA-B27–associated AU, DRB1*0101 and DQB1*0501 were increased compared with HLA-B27–positive control subjects. When HLA-B27 subtype distribution was compared among the groups, the proportion of B*2704 was significantly lower in HLA-B27–associated AU (P = 0.037), however, such a difference was not present in AS-associated groups.

conclusions. These results indicated that B*2704 seemed to be less susceptible to AU compared with B*2705 in Japanese subjects. The increase of HLA-DR12 and HLA-DR1 in AU may be caused by linkage disequilibrium with B*2704 and B*2705, respectively.

Anterior uveitis (AU) refers to inflammation mainly involving the anterior segment of the eye, namely the iris and the ciliary body. It develops in some patients as a complication of ankylosing spondylitis (AS), Reiter’s syndrome, juvenile rheumatoid arthritis, or psoriatic arthritis. They are named and classified by the criteria based on systemic diseases—for example, AS-associated AU. ¹  

Anterior uveitis is closely associated with HLA-B27. Because this association is observed regardless of the presence of AS, HLA-B27–associated AU appears to be a distinct clinical entity. A substantial proportion of cases of AU are of unknown origin in Japan ² and are termed idiopathic AU. Although some of the clinical features are different, it is difficult to distinguish these three groups solely from ocular features and symptoms. ³  

The incidence of AU in Japanese people is less frequent than in whites. In the outpatient clinic of Tokyo University Hospital, 2.4% of all outpatients attending an ophthalmology clinic received a diagnosis of uveitis, ² and approximately 25% of those were diagnoses of AU. ² In contrast, AU is the most common form of uveitis in whites, accounting for approximately 75% of cases. ⁴ HLA-B27 shows high frequency, even in Japanese patients with AS and AU, although only 0.8% of the general Japanese population possesses HLA-B27, compared with 4% to 13% of whites. ⁵ Only limited information has been available concerning HLA-B27 and AU in Japanese people, because of the difficulty in collecting a sufficient number of samples. 

In this study, a substantial number of Japanese patients with AS-associated AU, HLA-B27–associated AU, and idiopathic AU were investigated to determine whether there are differences in the frequency of HLA-B27 subtypes or HLA class II alleles among the three groups. 

Methods

Subjects

Seventy-three patients with AU were studied. The diagnosis of AU was determined clinically by ophthalmologists in the uveitis clinic according to the criteria recommended by Rothova et al. ³ Ankylosing spondylitis was diagnosed according to New York criteria by orthopedic medical specialists. ⁶ The patients were classified into three groups according to the criteria of Nussenblatt et al. ¹ Thirty-one patients (27 men and 4 women) were classified as having AS-associated AU, 14 patients (8 men and 6 women) as having HLA-B27–associated AU, and 28 patients (11 men and 17 women) as having idiopathic AU. Patients with Fuch’s heterochromic iridocyclitis, Posner–Schlossman’s syndrome, ulcerative colitis, and Crohn’s disease were excluded because these conditions were considered to constitute distinct entities. The average age of AU onset was 40.5 ± 11.4 years (in men) and 43.7 ± 15.4 years (in women). All these patients were of Japanese origin and unrelated to one another. They were diagnosed and treated in the University of Tokyo Hospital, Mitsui Memorial Hospital, and Kurume Medical College Hospital during the period from May 1992 through June 1997. Two groups of healthy control subjects were also studied, which included 138 non-HLA matched subjects (random control subjects) and 33 HLA-B27–positive subjects. For the reference of another group of HLA-B27 subtype, 19 patients with AS without AU were included in this study. They were the blood donors and staff at Saitama Medical School, the Japanese Red Cross Central Blood Center, and the Japanese Red Cross Nagano Blood Center. The study was approved by the Ethics Committee of the University of Tokyo School of Medicine. Informed consent was obtained from each subject before participation in the study. The tenets of the Helsinki Declaration were followed. 

HLA Genotyping

Venous blood was obtained from each patient and control subject, and the serologic HLA tissue typing for class I and II specificity was performed by the standard National Institutes of Health complement-dependent microlymphocyte toxicity test. Genomic DNAs were extracted from peripheral blood using the phenol-chloroform method. HLA-B27 alleles were detected by nested polymerase chain reaction (PCR)–single-strand conformation polymorphism (SSCP). ⁷ The PCR reaction was conducted with DNA polymerase (Ampli-Taq; Perkin Elmer Cetus, Norwalk, CT). Briefly, the B locus was amplified with the sense and antisense primer pairs described in Table 1 . The reaction mixture was subjected to 30 cycles of 22 seconds at 94°C for denaturation, 50 seconds at 65°C for primer annealing, and 30 seconds at 72°C for extension in an automated thermal cycler (Perkin Elmer Cetus). Then, B*27 exons 2 and 3 were amplified with specific primers for each (Table 1) from the diluted B locus products. The reaction mixture was subjected to 30 cycles of 10 seconds at 96°C, 20 seconds at 64 to 67°C, and 20 seconds at 70°C for extension. Each of the amplified HLA-B27 products was detected by SSCP, as previously described. ⁷ Briefly, 2.5 μl of PCR products was diluted with 10 μl SSCP buffer (95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene cyanol). These samples were boiled 5 minutes at 95°C for denaturation, cooled in ice water and applied to the 8% to 10% polyacrylamide gel. The samples were subjected to electrophoresis in 0.5× Tris-borate-EDTA buffer (0.5× TBE) at 20 to 30 mA for 2 to 3 hours. The SSCP gel was visualized with silver staining using a commercial silver staining kit (Bio-Rad, Hercules, CA), and the difference of the pattern was compared with reference samples. A few samples in each subtype group were confirmed for the allele by sequencing-based typing. 

HLA-DRB1 and HLA-DQB1 genotyping was performed by PCR-SSCP and PCR-restriction fragment length polymorphism (RFLP), as previously described. ⁸ Briefly, DRB1 and DQB1 PCR was performed with group-specific primer pairs for the selective amplification of each second exon. The sequences of the primers are shown in Table 2 . The PCR reaction was conducted with DNA polymerase (Ampli-Taq) or thermally activated DNA polymerase (Ampli-Taq Gold (both from Perkin Elmer Cetus). The PCR condition for DRB1 was 30 cycles of 1 minute at 96°C, 1 minute at 54°C to 61°C, and 30 to 60 seconds at 72°C in an automated thermal cycler. The PCR condition for DQB1 was 30 cycles of 30 seconds at 96°C, 30 seconds at 57°C, and 30 seconds at 72°C in an automated thermal cycler. SSCP was performed as described in HLA-B27 genotyping. 

RFLP was performed for the samples that were difficult to genotype with SSCP only. Five microliters of the PCR product was incubated and digested with the recommended buffer and appropriate restriction enzyme ⁸ at 37°C for 2 to 3 hours. Samples were subjected to electrophoresis in 8% to 12% polyacrylamide gel in 0.5× TBE buffer at 20 to 30 mA for 30 minutes. Digested fragments were visualized by staining with ethidium bromide. 

Statistical Analysis

The χ² method with the continuity correction and Fisher’s exact probability test were used for data analysis, when appropriate. Statistical significance was defined as P < 0.05, and P was corrected (Pc) for the member of comparison where necessary. Odds ratios were calculated by Haldane’s modification of Woolf’s method. Briefly (a × d)/(b × c), where a, b, c, and d are the numbers of marker-positive patients, marker-negative patients, marker-positive control subjects, and marker-negative control subjects, respectively. 

Results

Table 3 shows HLA class I phenotype frequencies in the AS-associated AU group, the HLA-B27–associated AU group, the idiopathic AU group, and random control subjects. The most striking difference was seen in HLA-B27: 93.5% (29/31) in the AS-associated AU group, 100% (14/14) in the HLA-B27–associated AU group, 0% (0/28) in the idiopathic AU group, and 0.7% (1/138) in random control subjects. No other class I antigens showed significant differences when P was corrected for the number of comparisons. Table 4 shows the HLA class II phenotype frequencies among the same groups. HLA-DR1 showed significantly increased frequency (50.0%) in the HLA-B27–associated AU group compared with the control subjects (8.0%). The frequency of HLA-DR12 was significantly increased in the AS-associated AU group (22.6%) compared with the control group (4.3%). No differences were found between idiopathic AU and the random control groups  

We next focused on the HLA-B27–positive subjects to avoid the bias caused by the possession of HLA-B27, and compared HLA class II alleles and HLA-B27 subtypes at the sequence level among AS-associated AU, HLA-B27–associated AU, and HLA-B27–positive healthy subjects  

Table 7 shows the distribution of HLA-B27 subtypes among the three groups and in patients with AS without AU. Of interest, the proportion of B*2704 positive subjects was significantly smaller in the HLA-B27–associated AU group (50.0%) than in control subjects (81.8%; P = 0.037). Such a difference was not observed in patients with AS, regardless of the presence of AU. 

Discussion

Although the role of HLA-B27 in the susceptibility to AS has been investigated in various ethnic groups, little is known about the ethnic difference in the relationship between HLA-B27 and AU. One of the reasons may be the difficulty in making the diagnosis of AU after the inflammation has subsided, because the severe phase of AU usually disappears in several weeks. HLA-B27 is considered to be associated with both AS and AU, but HLA-B27 seems to influence the susceptibility to AS more strongly than that to AU. ^{4 9} It is possible that the analysis of genetic factors in patients with AS-associated AU are strongly influenced by the presence of AS. Therefore, genetic factor(s) primarily involved in AU should be analyzed in patients who have AU without AS to avoid the influence of genetic factor(s) in AS. 

The major finding in this study was the difference in the susceptibility to AU among HLA-B27 subtypes in Japanese people. Among the 12 HLA-B27 subtypes (B*2701–B*2712 thus far identified), B*2711 has been reported only in Japanese people but not in various ethnic populations. ¹⁰ Other B*27 subtypes, B*2701, B*2702, B*2703, B*2706, B*2707, B*2708, B*2709, B*2710, and B*2712, were not detected in our Japanese subjects. A difference in the susceptibility to AU among HLA-B27 subtypes was not reported in whites. ⁴ Because B*2705 and B*2702 account for the majority of HLA-B27 subtypes in whites, it can be interpreted that there is no difference in the susceptibility to AU between B*2702 and B*2705. In this study, B*2704 was detected significantly less frequently than B*2705 in the HLA-B27–associated AU group than in HLA-B27–positive control subjects. A similar finding was recently reported by Goto et al. ¹¹ Because both of the subjects were of Japanese ancestry, and none of the patients with AU in their study had AS, their data were combined with ours and were reanalyzed (Table 8) . The result also shows the difference in HLA-B27 subtype distribution between HLA-B27–associated AU and HLA-B27–positive control subjects. 

In the case of AS, B*2706 and B*2709 were reported to have negative associations. ^{12 13 14} It is speculated that differences in the affinity between potential pathogenic peptides and the HLA-B27 peptide-binding pocket may influence the degree of susceptibility conferred by each subtype. This affinity may be influenced by the characteristics of HLA-B27 amino acid residues outside the B pocket, especially in the F and D/E pockets. ¹³ B*2704, B*2706, and B*2710 possess the same residue at 152 in pocket E, which is different from other HLA-B27 subtypes. B*2710, which is different at only 152 amino acid residues from B*2705, were reported to have weak affinity with T-cell receptor. ¹⁵ From these data, it could be speculated that B*2704 has a relatively weak affinity with the AU-specific peptides or weak antigen recognition for T-cell receptor. Because the eye is known to be an immunologically privileged site, ¹⁶ it is likely that antigenic peptides presented by HLA-class I are different from those in other tissues, such as spine. 

We also detected a slight differences in frequencies of HLA-DR12 and HLA-DR1. HLA-DR12 was increased in AS-associated AU compared with incidence in random control subjects but failed to show increased frequency when compared with HLA-B27–positive control subjects, suggesting that the increase of HLA-DR12 was caused by linkage disequilibrium with HLA-B27. Conversely, slight increases in the proportions of DRB1*0101 and DQB1*0501 were present in HLA-B27–associated AU, even compared with that in HLA-B27–positive control subjects. It is known that DRB1*0101 and DQB1*0501 are in tight linkage, ⁵ and the linkage disequilibrium between B*2705-DR1 has been observed in populations world-wide. ^{5 12} In fact, we recently reported that HLA-DRB1*1202 and HLA-DRB1*0101 are in linkage disequilibrium between HLA-B*2704 and HLA-B*2705, respectively, in the Japanese population. ¹⁷ Based on these findings, it is thought that the difference in DR12 and DR1 frequency was caused by the linkage disequilibrium with HLA-B27 subtypes. However, it remains to be determined which of the HLA-B*2705 and DRB1*0101-DQB1*0501 has the primary effect on the susceptibility to AU. 

No HLA differences were found in those with idiopathic AU compared with random control subjects. It remains unclear whether the pathogenesis of idiopathic AU is similar to HLA-B27–associated AU, despite the similarity in clinical features. 

The relationship between HLA-B27 subtypes and development of AS or AU suggests the possibility of graded susceptibility to both diseases, instead of the all-or-nothing rule. This scenario could be accepted easily under conditions in which several kinds of pathogenic peptides with different affinity for the HLA-B27 subtypes are involved in the pathogenesis. The disease susceptibility differences could be explained not only with HLA-B27 subtypes, but the binding affinities of pathogenic peptides may also be taken into consideration. 

 Reprint requests: Jiro Numaga, 3-2-1-214, Nishigahara, Kita-ku Tokyo 114-0024, Japan.

 Supported in part by a Grant-in-Aid for Scientific Research (C) No. 07671903 from the Ministry of Education, Science and Culture, Japan.

 Submitted for publication September 15, 1998; revised February 11, 1999; accepted March 3, 1999.

 Proprietary interest category: N.

 

Table 1.

 

Primer Sets to Amplify B Locus, HLA-B27 Exon 2 and Exon 3

Locus/Exon			Sequence (5′–3′)
B locus	Forward	5Bln1–57	GGG AGG AGC GAG GGG ACC GCA G
	Reverse	3Bln3–37	GGA GGC CAT CCC CGG CGA CCT AT
HLA-B27
exon2	Forward	E40s	GCCGCGAGTCCGAGAGA
	Reverse	E90as	GGCCTCGCTCTGGTTGTA
exon3	Forward	E91 As	GGGTCTCACACCCTCCAGAAT
	Reverse	E136as	CGGCGGTCCAGGAGCT
exon3	Forward	E91Bs	GGGTCTCACACCCTCCAGAGC
(B*2707, B*2711)	Reverse	E181as	GCGCTGCAGCGTCTCCTT

Table 2.

 

Group-Specific Primer Sets to Amplify DRB1 and DQB1 Allele

DRB1
for DR1	Forward		GGTTGCTGGAAAGATGCATCT
for DR2			TTCCTGTGGCAGCCTAAGAGG
for DR4			GTTTCTTGGAGCAGGTTAAAC
for DR7			AGTTCCTGGAAAGACTCTTCT
for DR9			GAAGCAGGATAAGTTTGAGTG
for DR10			GGTTGCTGGAAAGACGCGTCC
for DR3, 5, 6, 8			ACGTTTCTTGGAGTACTCTACG
	Reverse		CCGCTGCACTGTGAAGCTCT
DQB1
for DQ1	Forward	GH28NL	GCATGTGCTACTTCACCAACG
	Reverse	QB202	CACCTGCAGATCCCGCGGTACGCCACCTC
for DQ2, 3, 4	Forward	GH28NL	GCATGTGCTACTTCACCAACG
	Reverse	QB204	CACCTGCAGTGCGGAGCTCCAACTGGTA

Table 3.

 

HLA Class I Antigen Frequencies in AS-Associated, B27-Associated, Idiopathic AU, and Random Control Groups

Class I Antigen	Anterior Uveitis											Random Controls
		AS-Associated			B27-Associated			Idiopathic
		n = 31	(%)	n = 14	(%)	n = 28	(%)	n = 138	(%)
A1	0	(0)	0	(0)	0	(0)	0	(0)
A2	18	(58.1)	8	(57.1)	9	(32.1)	55	(39.9)
A11	5	(16.1)	6	(42.9)	6	(21.4)	24	(17.4)
A24	20	(64.5)	6	(42.9)	20	(71.4)	83	(60.1)
A26	5	(16.1)	0	(0)	6	(21.4)	31	(22.5)
A28	0	(0)	1	(7.1)	0	(0)	0	(0)
A30	0	(0)	1	(7.1)	1	(3.6)	1	(0.7)
A31	6	(19.4)	1	(7.1)	6	(21.4)	29	(21.0)
A33	5	(16.1)	0	(0)	1	(3.6)	22	(15.9)
B7	2	(6.5)	1	(7.1)	4	(14.3)	13	(9.4)
B13	0	(0)	1	(7.1)	2	(7.1)	4	(2.9)
B17	0	(0)	0	(0)	0	(0)	1	(0.7)
B27	29	(93.5)*	14	(100), †	0	(0)	1	(0.7)
B35	3	(9.7)	0	(0)	3	(10.7)	24	(17.4)
B37	0	(0)	0	(0)	0	(0)	1	(0.7)
B39	1	(3.2)	0	(0)	3	(10.7)	9	(6.5)
B40	0	(0)	0	(0)	0	(0)	1	(0.7)
B44	4	(12.9)	1	(7.1)	2	(7.1)	25	(18.1)
B46	3	(9.7)	3	(21.4)	1	(3.6)	16	(11.6)
B48	0	(0)	0	(0)	0	(0)	5	(3.6)
B51	2	(6.5)	2	(14.3)	7	(25.0)	25	(18.1)
B52	9	(29.0)	3	(21.4)	8	(28.6)	33	(23.9)
B54	2	(6.5)	0	(0)	6	(21.4)	23	(16.7)
B55	0	(0)	2	(14.3)	0	(0)	4	(2.9)
B56	0	(0)	0	(0)	1	(3.6)	6	(4.3)
B59	0	(0)	0	(0)	1	(3.6)	2	(1.4)
B60	1	(3.2)	0	(0)	5	(17.9)	10	(7.2)
B61	2	(6.5)	0	(0)	4	(14.3)	27	(19.6)
B62	4	(12.9)	1	(7.1)	6	(21.4)	24	(17.4)
B67	0	(0)	0	(0)	1	(3.6)	2	(1.4)
B70	0	(0)	0	(0)	0	(0)	2	(1.4)
B75	0	(0)	0	(0)	0	(0)	2	(1.4)
Cw1	14	(45.2)	10	(71.4)	9	(32.1)	47	(34.1)
Cw3	8	(25.8)	1	(7.1)	11	(39.3)	62	(44.9)
Cw4	2	(6.5)	1	(7.1)	2	(7.1)	18	(13.0)
Cw5	0	(0)	0	(0)	0	(0)	1	(0.7)
Cw6	0	(0)	1	(7.1)	1	(3.6)	2	(1.4)
Cw7	2	(6.5)	1	(7.1)	8	(28.6)	30	(21.7)
Cw8	0	(0)	0	(0)	0	(0)	1	(0.7)
Cw9	5	(16.1)	0	(0)	7	(25.0)	29	(21.0)
Cw10	3	(9.7)	0	(0)	4	(14.3)	22	(15.9)

*   P = 5.6 × 10⁻³³, Pc = 1.3 × 10⁻³¹,χ ² = 143.1; odds ratio = 1987 compared with random controls.

†   P = 4.3 × 10⁻³⁰, Pc = 1.0 × 10⁻²⁸,χ ² = 129.9; odds ratio = 2658 compared with random controls.

Table 4.

 

HLA Class II Antigen Frequencies in AS-Associated, B27-Associated, Idiopathic AU, and Random Control Groups

Class II Antigen	Anterior Uveitis											Random Controls
		AS-Associated			B27-Associated			Idiopathic
		n = 31	(%)	n = 14	(%)	n = 28	(%)	n = 138	(%)
DR1	8	(25.8)	7	(50.0)*	5	(17.9)	11	(8.0)
DR2	10	(32.3)	1	(7.1)	10	(35.7)	47	(34.1)
DR3	0	(0)	0	(0)	0	(0)	0	(0)
DR4	8	(25.8)	5	(35.7)	9	(32.1)	60	(43.5)
DR6	7	(22.6)	2	(14.3)	9	(32.1)	47	(34.1)
DR7	0	(0)	0	(0)	1	(3.6)	2	(1.4)
DR8	12	(38.7)	5	(35.7)	9	(32.1)	34	(24.6)
DR9	4	(12.9)	3	(21.4)	5	(17.9)	41	(29.7)
DR10	0	(0)	0	(0)	0	(0)	2	(1.4)
DR11	1	(3.2)	2	(14.3)	1	(3.6)	2	(1.4)
DR12	7	(22.6), †	2	(14.3)	4	(14.3)	6	(4.3)
DR13	4	(12.9)	1	(7.1)	2	(7.1)	22	(15.9)
DR14	2	(6.5)	1	(7.1)	4	(14.3)	15	(10.9)
DRHR5	2	(6.5)	0	(0)	1	(3.6)	4	(2.9)
DRHR6	0	(0)	0	(0)	1	(3.6)	7	(5.1)
DR52	14	(45.2)	6	(42.9)	13	(46.4)	54	(39.1)
DR53	13	(41.9)	8	(57.1)	15	(53.6)	94	(68.1)
DQ1	24	(77.4)	10	(71.4)	22	(78.6)	100	(72.5)
DQ2	0	(0)	0	(0)	0	(0)	2	(1.4)
DQ3	17	(54.8)	8	(57.1)	13	(46.4)	78	(56.5)
DQ4	4	(12.9)	6	(42.9)	9	(32.1)	48	(34.8)
DQ7	10	(32.3)	2	(14.3)	8	(28.6)	25	(18.1)
DQ6.1	1	(3.2)	1	(7.1)	5	(17.9)	14	(10.1)

*   P = 0.00021, Pc = 0.0035; odds ratio = 11.5 compared with random controls.

†   P = 0.00283, Pc = 0.048; odds ratio = 6.4 compared with random controls.

Table 5.

 

DRB1 Allelic Frequencies among the HLA-B27–Positive Groups with AS-Associated AU and HLA-B27–Associated AU and Controls

DRB1*	AS-Associated AU			B27-Associated AU			Controls
		n = 29	(%)	n = 14	(%)	n = 33	(%)
0101	8	(27.6)	7	(50.0)*	4	(12.1)
1501	3	(10.3)	0	(0)	3	(9.1)
1502	5	(17.2)	1	(7.1)	2	(6.1)
1602	0	(0)	0	(0)	1	(3.0)
03	0	(0)	0	(0)	0	(0)
0405	4	(13.8)	5	(35.7)	11	(33.3)
0410	1	(3.4)	0	(0)	0	(0)
0401	0	(0)	0	(0)	0	(0)
0404	0	(0)	0	(0)	1	(3.0)
0403	1	(3.4)	0	(0)	2	(6.1)
0406	3	(10.3)	0	(0)	0	(0)
0407	0	(0)	0	(0)	0	(0)
1101	1	(3.4)	2	(14.3)	3	(9.1)
1201	2	(6.9)	1	(7.1)	3	(9.1)
1202	5	(17.2)	1	(7.1)	4	(12.1)
1301	0	(0)	0	(0)	1	(3.0)
1302	4	(13.8)	1	(7.1)	1	(3.0)
1401	2	(6.9)	0	(0)	3	(9.1)
1405	0	(0)	0	(0)	2	(6.1)
1402	2	(6.9)	0	(0)	0	(0)
1406	0	(0)	0	(0)	3	(9.1)
1403	0	(0)	1	(7.1)	0	(0)
1412	0	(0)	0	(0)	0	(0)
0701	0	(0)	0	(0)	0	(0)
0803	11	(37.9)	2	(14.3)	10	(30.3)
0802	1	(3.4)	2	(14.3)	1	(3.0)
0801	0	(0)	1	(7.1)	0	(0)
0901	4	(13.8)	3	(21.4)	7	(21.2)
1001	0	(0)	0	(0)	0	(0)

*   P = 0.0091, Pc = 0.18; odds ratio = 7.3 compared with controls.

Table 6.

 

DQB1 Allelic Frequencies among the HLA-B27–Positive Groups with AS-Associated AU and HLA-B27–Associated AU and Controls

DQB1*	AS-Associated AU			B27-Associated AU			Controls
		n = 29	(%)	n = 14	(%)	n = 16	(%)
0501	9	(31.0)	7	(50.0)†	1	(6.3)
0502	0	(0)	0	(0)	1	(6.3)
05031	2	(6.9)	0	(0)	1	(6.3)
0601	15	(51.7)	3	(21.4)	7	(43.8)
0602	2	(6.9)	0	(0)	1	(6.3)
0603	0	(0)	0	(0)	0	(0)
0604	4	(13.8)	1	(7.1)	0	(0)
0605/9	0	(0)	0	(0)	0	(0)
0201	0	(0)	0	(0)	0	(0)
0301	10	(34.5)	4	(28.6)	5	(31.3)
0302	5	(17.2)	1	(7.1)	2	(12.5)
0303	3	(10.3)	3	(21.4)	4	(25.0)
0401	4	(13.8)	5	(35.7)	7	(43.8)
0402	0	(0)	1	(7.1)	0	(0)

†   P = 0.012, Pc = 0.17; odds ratio = 15.0 compared with controls.

Table 7.

 

HLA-B27 Subtype Distribution in HLA-B27–Positive Subjects

HLA-B27 Subtype	AS-Associated AU			B27-Associated AU			AS without AU			Controls
		n = 29	(%)	n = 14	(%)	n = 19	(%)	n = 33	(%)
B, * 2704	21	(72.4)	7	(50.0), *	17	(89.5)	27	(81.8)
Other B, * 27 subtype, †	8	(27.6)	7	(50.0)	2	(10.5)	6	(18.2)

*   P = 0.037; odds ratio = 4.5 compared with controls.

†  All subjects in this group possessed B

*  2705 except one control who possessed B

*  2711.

Table 8.

 

HLA-B27 Subtype Distribution in HLA-B27–Positive Subjects: Combined Data from Present Study and Results from Goto et al. ¹¹

HLA-B27 Subtype	HLA-B27 Positive Individuals
		B27-Associated AU			Controls
		n = 31	(%)	n = 53	(%)
B* 2704	17*	(54.8)	43	(81.1)
Other B* 27 Subtypes	14	(45.2)	10	(18.9)

*   P = 0.0101; χ² = 6.6.

The authors thank those who participated in this study; Satoshi Saito, Nagano Red Cross Blood Center, who kindly shared HLA-B27 healthy control DNA samples; and Ranko Hirata, Blood Transfusion Service, Saitama Medical Center, who performed HLA serologic typing.