Expression of Estrogen Receptor α and β in the Mouse Cornea

Abstract

purpose. To test the possibility that estrogen has a direct effect on corneal cells, the possible occurrence of estrogen receptor alpha (ERα) and beta (ERβ) in the cornea of mice was examined.

methods. To test for the occurrence of ER proteins in the cornea of mice, an immunocytochemical method was used. To test for the occurrence of ER mRNAs in the cornea of mice, reverse transcription–polymerase chain reaction (RT–PCR) was used.

results. Immunocytochemical examination revealed that both ERα and ERβ exist in the cell nuclei of corneal epithelial, stromal, and endothelial cells of both male and female mice. RT–PCR revealed that RNAs of ERs occur in the cornea of both male and female mice.

conclusions. Because ERα and ERβ occur in corneal cells of mice, estrogen may exert biological functions in corneal cells through direct interaction with these ERs.

Some studies have revealed a cyclic variation in women’s cornea across the menstrual cycle. For example, a steeping of horizontal and vertical curvature at the beginning of the cycle and a cyclic variation of corneal thickness through the menstrual cycle (for review see ^{Ref. 1)} . Moreover, it has been shown that hormone replacement therapy for postmenopausal symptoms with estrogen and progesterone derivatives causes corneal thickening. ² These findings suggest that estrogen and progesterone have some effect, direct or indirect, on the corneal anatomy. To test the possibility that estrogen has a direct effect on corneal cells, we examined the possible occurrence of estrogen receptor alpha (ERα) and beta (ERβ) in the cornea of mice. Studies by two independent methods revealed that both ERα and ERβ do occur in these cells of male and female mice. 

Methods

Animals

BALB/c NCrj mice of both sexes were purchased from a local vender (CLEA Japan, Tokyo, Japan) and used at approximately 4 months of age. All animals were treated according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 

Immunocytochemical Detection of ERs

Immediately after the death of mice by cervical dislocation under ether anesthesia, eyeballs of three male and three female mice approximately 4 months of age were isolated. Tissues were immersed in 10% buffered formalin overnight, dehydrated in a graded series of ethanol, and embedded in paraffin. Sections of approximately 4 μm were cut, mounted onto glass slides, and deparaffinized with xylene and graded concentrations of ethanol. Alternatively, fresh tissues were frozen with dry ice ejected from a tank with liquid CO₂, after which frozen sections of approximately 7 μm were cut and mounted onto glass slides. To enhance antigenicity, the sections were immersed in 10 mM citrate buffer (pH 7.4) and treated in an 800 W microwave at boiling temperature for 8 minutes. Next, to inhibit endogenous peroxide activity, sections were treated with 0.3% hydrogen peroxide in methanol. After incubation with rabbit polyclonal anti-ERα antibody (4 μg/ml, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-ERβ antibody (50 μg/ml, Affinity Bioreagents, Golden, CO) at 4°C overnight, sections were immunostained by streptavidin–biotin complex method using Histofine SAB-PO(R) kit (Nichirei, Tokyo, Japan) according to the manufacturer’s recommendation. Reaction complex was visualized by treatment with 0.05% 3,3′-diaminobenzidine tetrahydrochloride and 0.03% hydrogen peroxide in 50 mM Tris–HCl buffer (pH 7.6). Sections were then dehydrated by concentrations of ethanol, mounted, and observed under a microscope. In control slides, normal rabbit serum was used in place of antibody. 

RT–PCR

Immediately after the death of mice by cervical dislocation under ether anesthesia, eyeballs of male and female mice approximately 4 months of age were isolated. Corneas were further dissected under the stereomicroscope. Testes, which have been shown to be enriched with ER, ³ were obtained from male mice and used for positive control. RNAs were extracted from these tissues using 4 M guanidium isothiocyanate (pH. 4.0) and Catrimox-14 RNA isolation kit (Takara Biomedicals, Kyoto, Japan), according to the manufacturer’s instruction. Approximately 1 μg of total RNAs was reverse–transcribed with AMV reverse transcriptase, random primers, and RNA PCR kit (Takara), according to the manufacturer’s instruction. One tenth of resulting cDNA was used for further PCR amplification. PCR was performed for 45 cycles at 95°C for 30 seconds, 65°C for 1 minute, and 72°C for 25 seconds, and finally for 1 cycle at 72°C for 5 minutes in 20 μl of reaction mixture containing the cDNA template, 0.25 μM sense and antisense primers, 1 mM deoxyribonucleotide triphosphate (dATP, dTTP, dGTP and dCTP), 0.5 U of Pyrobest DNA polymerase (Takara). Primers used for amplification of mouse ERα and ERβ cDNAs were designed from a previously reported cDNA sequences. ^{4 5} Sequence of sense primer for ERα was GACCAGATGGTCAGTGCCTT (position 1139–1158), and that of antisense primer was ACTCGAGAAGGTGGACCTGA (position 1343–1324). Sequence of sense primer for ERβ was CAGTAACAAGGGCATGGAAC (position 1280–1299), and that of antisense primer was GTACATGTCCCACTTCTGAC (position 1522–1503). Primers used for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) cDNA amplification were designed from a reported GAPDH cDNA sequence ⁶ ; sequence of sense primer was ATGGTGAAGGTCGGTGTGAAC, whereas that of antisense primer was GCCTTGACTGTGCCGTTGAAT. PCR products were analyzed on 1% agarose gel stained with ethidium bromide. Specific-sized PCR products were recovered from the gel using QIAEX II gel extraction kit (Qiagen, Hilden, Germany) and used for templates of nucleotide sequencing. The sequencing was carried out using ABI PRISM cycle sequencing kit (Perkin–Elmer, Norwalk, CT) and ABI PRISM 310 gene analyzer. 

Results

In immunocytochemical studies of paraffin sections of formalin-fixed corneas, we observed the expression of ERα protein (Figs. 1A 1B 1C) but not that of ERβ protein. However, the latter was found in unfixed cryosections (Figs. 1B 1C) . Both ERα and ERβ were localized in nuclei of epithelial, stromal, and endothelial cells of the cornea of both male and female mice, with no apparent gender difference observed in their expression. 

RT–PCR studies revealed that transcripts of both ERα and ERβ were expressed in the corneas of female and male mice. The amplified transcripts were detected as a single band on an agarose gel in the cornea and testes (Figs. 1D 2D , arrowheads). The sizes of the amplicons were identical among these tissues and were identical with the expected sizes (i.e., 205 bp for ERα and 243 bp for ERβ). Nucleotide sequences of amplicons were identical with those of reported mouse ERα and ERβ cDNAs. ^{3 4}  

Discussion

Occurrence of mRNA for ERα was previously demonstrated in rat, rabbit, and human corneas. ⁶ In the present study we demonstrated the expression of ERα and ERβ in corneal cells of both male and female mice at the protein and transcript levels. Although previous immunocytochemical studies showeddifferential expression of ERα and ERβ in some tissues including ovary and uterus, ⁷ we did not observe an apparent difference in the expression pattern in the cornea. These data are consistent with the notion that estrogen, which is probably supplied through tears and aqueous humor, interacts with ERα and ERβ in corneal cells and exerts the biological effects that include, as is well known, retention of water and sodium. ⁸  

Cyclic variation of corneas across the menstrual cycle in human females was first noticed some three decades ago. In 1970, Manchester ⁹ reported a change in corneal hydration across the menstrual cycles in ovulating women. Since then many studies have found cyclical variation in corneal thickness across the menstrual cycle: most found the thickening of the cornea at ovulation (for review see ^{Ref. 1)} . And because it has also been reported that corneal thickness increases during pregnancy, ¹⁰ there is a strong indication of an association between corneal thickness and estrogen level. 

Variations of thickness across the menstrual cycle have been observed in the skin as well: Eissenbeiss et al. ¹¹ reported that skin thickness increases from days 2 to 4 through days 12 to 14 of the menstrual cycle. This phenomenon may be attributed to systemic water retention due to factors such as estrogen-induced upregulation of renin-aldosterone system. ¹² However, the mechanism for cyclic variation may also involve the local effect of estrogen through interaction with ER, which has been shown to occur in the skin. ¹³ Topical application of estrogen to the rodent skin is reported to increase hyaluronic acid and water content and accelerate cutaneous wound healing. ^{14 15}  

Despite substantial evidence for physiological/pathophysiological function of estrogen and its receptors in the skin, their function in the cornea remains to be studied. Moreover, others’ studies did not find the occurrence of ER in the human cornea. ¹⁶ The discrepancy between their finding and our present finding may be due to differences of species or methods used. As a first step to address these points, we are now examining the occurrence of ERs in the human cornea by the methods used in this study. 

 Submitted for publication July 22, 1999; revised September 24, 1999; accepted October 26, 1999.

 Commercial relationships policy: N.

 

Figure 1.

 

Demonstration of ERα in mouse corneas by immunocytochemistry on paraffin sections (A, B, C) and RT–PCR (D). (A, B) Immunoreactivity for ERα was observed in nuclei of corneal cells (i.e., epithelial, stromal, and endothelial cells of male [A] and female[ B] mice). (C) Control section in which normal rabbit serum was used in place of antibody. No specific staining was observed. (D) Lane 1, Cornea of male mice; lane 2, cornea of female mice; lane 3, testes; and lane 4, non-RT control. Upper panel demonstrates amplicons for ERα, and lower panel demonstrates those for GAPDH. Specific amplicons for ERα are observed in lanes 1 through 3 (arrowhead) but not in lane 4. Nonspecific bands are observed in all lanes.

Figure 2.

 

Demonstration of ERβ in mouse corneas by immunocytochemistry on cryosections (A, B, C) and RT–PCR (D). (A, B) Immunoreactivity for ERβ was observed in nuclei of corneal cells (i.e., epithelial, stromal, and endothelial cells of male [A] and female [B] mice). (C) Control section in which normal rabbit serum was used in place of antibody. No specific staining was observed. (D) Lane 1, Cornea of male mice; lane 2, cornea of female mice; lane 3, testes; and lane 4, non-RT control. Upper panel demonstrates amplicons for ERβ, and lower panel demonstrates those for GAPDH. Specific amplicons for ERβ are observed in lanes 1 through 3 (arrowhead) but not in lane 4.

The authors thank Kaname Kawajiri and Hidetaka Eguchi for their valuable discussion and Eiju Tsuchiya for continuous encouragement.