A Novel Gene for Autosomal Dominant Stargardt-like Macular Dystrophy with Homology to the SUR4 Protein Family

Abstract

purpose. To describe a novel gene causing a Stargardt-like phenotype in a family with dominant macular dystrophy and the exclusion of all known genes within the disease locus.

methods. Meiotic breakpoint mapping in a family of 2314 individuals enabled refinement of the location of the disease gene. The genomic organization and expression profile of known and putative genes within the critical region were determined using bioinformatics, cDNA cloning, and RT-PCR. The coding sequence of genes expressed within the retina was scanned for mutations, by using DNA sequencing.

results. The disease-causing gene (STGD3) was further localized to 562 kb on chromosome 6 between D6S460 and a new polymorphic marker centromeric to D6S1707. Of the four genes identified within this region, all were expressed in the retina or retinal pigment epithelium. The only coding DNA sequence variant identified in these four genes was a 5-bp deletion in exon 6 of ELOVL4. The deletion is predicted to lead to a truncated protein with a net loss of 44 amino acids, including a dilysine endoplasmic reticulum retention motif. The ELOVL4 gene is the fourth known example of a predicted human protein with homology to mammalian and yeast enzymes involved in the membrane-bound fatty acid chain elongation system. The genomic organization of ELOVL4 and primer sets for exon amplification are presented.

conclusions. ELOVL4 causes macular dystrophy in this large family distributed throughout North America and implicates fatty acid biosynthesis in the pathogenesis of macular degeneration. The PCR-based assay for the 5-bp deletion will facilitate more accurate genetic counseling and identification of other branches of the family.

Macular dystrophies with subretinal flecks may arise from mutations at multiple disease loci, ^{1 2} the most common of which is the ABCA4 gene on chromosome 1 that gives rise to Stargardt disease (STGD1) or fundus flavimaculatus. ^{3 4} We previously reported a founder effect ^{2 5} for a dominant condition (STGD3) phenotypically similar to Stargardt disease localized to chromosome 6q. ^{2 6} A genealogical and molecular investigation of several families with autosomal dominant Stargardt-like macular dystrophy led to the recognition that all studied families were related through a common founder that immigrated to North America in 1730. ^{2 5 6 7 8} We also showed that the Stargardt-like disease (STGD2), previously reported to be linked to chromosome 13, ⁹ was actually a branch of the family we had been studying on chromosome 6. ⁵  

Disease-causing mutations segregating within single families can be difficult to identify with certainty, because all affected patients share the identical genomic DNA segment on which the founding mutation arose. Thus, all DNA sequence variation within the disease locus or critical region is shared by all affected patients and segregates with the trait. In addition to the customary criteria for distinguishing between polymorphisms and mutations, exclusion of other potential disease-causing sequence variation within the disease locus can confirm the mutation. ¹⁰ Therefore, it is critical to exclude sequence variation in all genes within the disease locus. 

The disease locus on chromosome 6q14 for this autosomal dominant Stargardt-like macular dystrophy family has been progressively refined to between novel markers within the region defined by D6S1625 and D6S1707 by us and between D6S460 and D6S391 by other groups. ^{11 12} While this manuscript was in preparation, a 5-bp deletion in the ELOVL4 gene in three branches of this family was reported by Zhang et al. ¹¹ In addition to ELOVL4, they reported exclusion of two other genes within their 3100-kb critical region between D6S460 and D6S391. ¹¹ We are aware of eight additional genes within their reported critical region that were not excluded and thus could harbor a disease-causing sequence variation. Herein, we report our independent identification and characterization of the gene for autosomal dominant Stargardt-like dominant macular dystrophy and the exclusion by DNA sequencing of the complete coding region of all candidate genes within our 562-kb critical region, defined by D6S460 and a novel marker (260P22.A) centromeric to D6S1707. The expression profile in human retina, genomic organization, and known functional information are presented for 15 genes in or near the critical region for STGD3 that are candidates for other chromosome 6q retinopathies. 

Materials and Methods

DNA Extraction

White blood cells were isolated by centrifugation of whole blood at 1000g and DNA purified with a kit (Masterpure Genomic DNA; Epicentre Technologies, Madison, WI), according to the manufacturer’s instructions. This research was approved by the institutional review boards and followed the tenets of the Declaration of Helsinki. 

Polymorphic Marker Identification, Amplification, and Analysis

Previously reported primers for short tandem repeat (STR) amplification were purchased from Research Genetics (Huntsville, AL). Novel dinucleotide (AC) _n repeat motifs were identified using a BLAST 2 Sequences search (available publicly from the National Center for Biotechnology Information [NCBI] at http://www.ncbi.nlm.nih.gov/BLAST/) of finished and unfinished genomic sequence within the STDG3 critical region produced by the Human Chromosome 6 Sequencing Group at the Sanger Centre (Cambridgeshire, UK) with an (AC)₆₀ sequence motif. Primers were designed in flanking sequence for amplification. Polymerase chain reactions (PCRs) were performed on genomic DNA (12.5 ng) in the presence of 1.5 mM MgCl, 1.25 nM each dNTP, 2.5 pM each primer, and 0.11 U Taq polymerase in a final volume of 6.5μ l under the following conditions: initial denaturation at 95°C for 4 minutes, followed by 30 cycles at 94°C for 10 seconds, 55°C for 10 seconds, and 74°C for 10 seconds, and then a final extension at 74°C for 5 minutes. Amplified products were denatured for 4 minutes at 94°C in the presence of formamide stop dye (6.5 μl), snap cooled on ice, resolved at room temperature on 8% denaturing polyacrylamide gels at 80 W, and transferred to nylon membranes (Roche Molecular Biochemicals, Indianapolis, IN) overnight. DNA was cross-linked to the membranes for 5 minutes (Photoprep I; Photodyne, Newberlin, WI). The immobilized products were denatured for 10 minutes in 0.4 M NaOH and neutralized in 2× SSC. 

An oligonucleotide containing an AC₁₅ repetitive sequence was 3′-tailed with digoxigenin (DIG)-11-dUTP and terminal transferase according to the manufacturer’s instructions (Roche Molecular Biochemicals) and hybridized to the resolved PCR products at 42°C in 5× SSC, 1% blocking reagent, 0.1% N-laurosarkosine, 0.02% SDS. Hybridized membranes were washed in 6× SSC and 0.1% SDS three times for 5 minutes, followed by a single wash in 0.1 M maleic acid, 0.15 NaCl, and 0.3% Tween-20 at pH 7.5 for 1 minute. The products were visualized by incubating membranes with alkaline phosphatase-conjugated anti-DIG antibody for 60 minutes, washing twice in 0.1 M maleic acid and 0.15 M NaCl at pH 7.5 for 15 minutes, followed by a single equilibration in 100 mM Tris-HCl, 100 mM NaCl, and 50 mM MgCL₂ at pH 9.5 for 2 minutes. The membranes were incubated with the chromogenic substrate (nitroblue tetrazolium chloride-5-bromo-4-chloro-3-indoyl phosphate 4-toludine sale [NBT/BCIP]) until the desired band intensity was achieved. All results were analyzed by at least two independent investigators and compared with a control sample (CEPH 1331-01) for registering genotypes between assays. 

Preparation of Human Retina and Retinal Pigment Epithelium

Adult human eyes were purchased from the Lions Eye Bank (Omaha, NE). The anterior segment was removed by circumferential incision posterior to the ora serrata. The retina was removed and snap frozen in liquid nitrogen. The retinal pigment epithelium (RPE)–choroid complex was rinsed with sterile Hanks’ balanced salt solution. The RPE was isolated with minor modifications of a previously described method. ¹³ Briefly, the RPE surface was treated with 0.25% trypsin and 0.5% EDTA in Hanks’ balanced salt solution at 37°C for 20 minutes or until the RPE cell layer appeared marbled. The trypsin solution was removed, and the RPE cells were dislodged and suspended with a stream of Ham’s F-12 medium without serum from a pipet. The cells were collected in sterile tubes and centrifuged at 50g for 3 minutes and then washed once in Hanks’ balanced salt solution and snap frozen in liquid nitrogen. These RPE preparations may contain photoreceptor-derived mRNA. 

Total RNA Isolation

Total RNA was prepared from retina and RPE by mincing with mortar and pestle in liquid nitrogen. The minced powder was collected into an RNA extraction reagent (RNA Stat-60; Tel-Test, Inc., Friendswood, TX). Total RNA was extracted as described by the manufacturer. 

RT-PCR and 5′-RACE

Total RNA (1 μg) was used to make cDNA with a first-strand synthesis system for RT-PCR (Superscript; Gibco-BRL, Rockville, MD), as described by the manufacturer. PCR was performed from cDNA using gene-specific primers as follows: 94°C for 5 minutes; 35 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds; and a final extension for 5 minutes at 72°C. Amplification products were analyzed by ethidium bromide-agarose gel electrophoresis. 5′-Rapid amplification of cDNA ends (5′-RACE) was performed with total RNA (10 μg) from human retina using the a kit (FirstChoice RLM-RACE; Ambion, Austin, TX), as described by the manufacturer. 

Retina cDNA Library

A cDNA library from two pooled human adult retinas was constructed using a predigested vector kit (ZAP Express; Stratagene, La Jolla, CA), as described by the manufacturer. Clones derived from the amplified library were identified using probes labeled with an enhanced chemiluminescence system (ECL Direct Nucleic Acid Labeling and Detection System; Amersham Pharmacia Biotech, Piscataway, NJ). Isolated clones were sequenced, and exon sequences were identified by a BLAST 2 Sequences search of the clone sequence against finished and unfinished genomic sequences. 

Mutation Scanning

Exons were amplified with primers designed in flanking intronic sequences. Direct DNA sequencing of the amplified products was performed in one affected and one unaffected patient to scan for DNA sequence variants. 

Genomic and Bioinformatic Resources

Genomic DNA sequence data referred to in this article were produced by the Chromosome 6 Sequencing Group at the Sanger Centre and can be obtained at http://www.sanger.ac.uk. A combination of the BLASTn, BLASTp, BLASTx, and BLAST 2 Sequences programs were used to identify sequences of candidate genes within the critical region. Putative CpG islands (regions of DNA at 200 bp in length with G+C content and a ratio of CpGs of 0.6 or above) within genomic sequences were identified using CpG Island software (available in the public domain from European Bioinformatics Institute [EBI], Cambridgeshire, UK, at http://www.ebi.ac.uk/cpg/). Transmembrane helix location and topology predictions were made by computer (PredictProtein software; provided in the public domain by European Molecular Biology Laboratory, Heidelberg, Germany, and available at http://www.embl-heidelberg.de/predictprotein.html) based on a previously described algorithm. ¹⁴ Potential phosphorylation sites were identified based on a primary- and secondary-structure–based algorithm. ¹⁵  

Results

Meiotic Breakpoint Mapping

We previously reported genealogical and molecular genetic studies demonstrating a common founder for all studied North American families with the autosomal dominant Stargardt-like phenotype. ^{2 5} Out of this family of 2314 individuals, 171 were clinically examined and 145 samples genotyped. Figure 1 shows the typical phenotype in a 52-year-old patient. 

We used both affected and unaffected individuals to refine the critical region for the STGD3 gene. Because the penetrance of autosomal dominant Stargardt-like macular dystrophy is nearly complete by the teenage years, observed in ophthalmoscopic examination, ^{2 6} unaffected patients with recombinant markers were used in the refinement. ^{2 5} Because of the possibility of a rare nonpenetrant individual, we used two critical regions: a larger critical region based only on affected patients and a smaller critical region based on affected and unaffected patients. Our positional candidate gene strategy was to screen first within the smaller region. 

The initial 20-centimorgan (cM) critical region ⁶ was progressively refined during the course of the study by using existing STR polymorphic markers. ^{16 17} The individuals with recombinant markers localizing the disease gene are presented in Table 1 . The 1.8-cM larger critical region defined by affected patients was between centromeric marker D6S1622 at 88.63 cM (patient S110) and telomeric marker D6S1707 at 90.43 cM (patient B3015). Using unaffected patients, the centromeric border was further refined to D6S1625 at 89.23 cM. ⁵ The approximate locations of these boundaries were confirmed by more than one patient with recombinant markers (Table 1) . 

Additional polymorphic STR markers were identified to further refine the critical region. Dimeric tandem repeats in the Sanger Centre chromosome 6 sequence were located and flanking oligonucleotides synthesized for amplification of these sites from 10 control DNA samples. The polymorphic subset of these dinucleotide markers is presented in Table 2 . The critical region was further refined to between 551A13.A and 260P22.A, based on all available patients with recombinant markers (Table 1) . Meiotic breakpoint data from unaffected patients previously described ^{11 12} enabled the critical region to be further refined to between D6S460 and 260P22.A. This allowed the exclusion of several additional genes, leaving four genes within the critical region of 562 kb, as will be described. 

Genomic Structure of the Critical Region

The larger critical region based on affected patients spans approximately 6000 kb on the Sanger Centre chromosome 6 database with four gaps, whereas the smaller critical region based on unaffected patients with recombinant markers spans 562 kb, as noted. Within these regions, we sought to identify genes based on the presence of homology to expressed sequence tags (ESTs), CpG islands, and a bioinformatic search for genes in genomic DNA sequence. Within the larger region we identified evidence for 15 potential and/or known genes based on multiple exons and EST clusters. Additionally, nine pseudogenes based on the absence of exons, presence of a poly(A) tail, and homology to a gene on another chromosome were identified (Fig. 2) . Twelve CpG islands were identified, of which two were not associated with a predicted or known gene (Fig. 2) . 

Screening of Candidate Genes

Expression of the candidate genes in the retina and RPE was determined by RT-PCR. Of the original 15 genes in the critical region based on affected individuals, 14 were expressed in one or both of these tissues (Table 3) . A combination of bioinformatic gene analysis, cDNA cloning, and 5′-RACE was used to determine the genomic structure of these genes. The exons and their flanking sequence within each of these genes were scanned for sequence variation by DNA sequencing in one affected and one unaffected patient (Table 3) . 

All the exons within all identifiable genes in the smaller critical region based on unaffected and affected patients (D6S460 to 260P22.A) were sequenced. The only coding-sequence variant identified in these four genes was a 5-bp deletion (Fig. 3) within exon 6 of a cDNA cloned using ESTs SG24780 and SG53542 as hybridization probes. The DNA sequence for the clone and predicted protein sequence for the wild type and mutant are given in Figure 4 . Primers for the amplification of the exons and their intronic borders for the ELOVL4 gene are given in Table 4 . 

Evidence for a Disease-Causing Mutation in the ELOVL4 Gene

The segregation of the 5-bp deletion within the extended family was examined by amplification of exon 6 to confirm that the sequence variant was located on the disease chromosome (data not shown). Four additional patient samples were sequenced to verify the presence of the 5-bp deletion in other affected individuals (data not shown). 

The 5-bp deletion would be predicted to cause a frameshift with a truncated protein. The truncation would delete 44 amino acids including the dilysine endoplasmic reticulum retention motif. This would be predicted to have a major effect on the function of the protein (Figs. 3 4) . 

To exclude this sequence variant as a polymorphism, exon 6 from 144 ethnically matched control individuals was amplified. All individuals exhibited the 334-bp normal band with no other alleles present, demonstrating the absence of this sequence variant on 288 control chromosomes. 

Given the expression of ELOVL4 in the retina, the predicted severity of the 5-bp deletion on protein function, and the absence of this sequence variant on 288 control chromosomes, this sequence variant appears to be the cause of autosomal dominant Stargardt-like macular dystrophy. Because any sequence variant within the critical region would segregate with disease in the family, and no unrelated families are known to exist, all other genes within the critical region were screened, and no coding sequence variations were identified (Table 3) . 

Expression of ELOVL4

Predicted and known genes within the disease locus for STGD3 were assayed for expression in RPE and neural retina isolated directly from human eyes using RT-PCR. Two of the expressed sequences were grouped together in a cluster that was ultimately identified as the STGD3 gene and both were expressed in both the neural retina and RPE preparations by RT-PCR (data not shown). No expression was identified in the kidney, demonstrating tissue-restricted expression of ELOVL4 according to RT-PCR (data not shown). No expressed pseudogenes have been identified for ELOVL4; thus, these expression results based on RT-PCR are likely to indicate the presence or absence of gene transcription. Because primary human RPE preparations may be contaminated with the overlying photoreceptors, Northern blot analysis for mRNA expression was performed. Northern blot analysis of human retina, RPE, and kidney revealed two transcripts in human retina only, demonstrating that ELOVL4 is expressed only in the retina at detectable levels (Fig. 5) . A search for alternative splicing using overlapping primer sets along the message and RT-PCR, failed to identify any evidence for size variation within the amplified products (data not shown). Based on these data, ELOVL4 transcripts appear to share identical coding sequences in the human retina. Thus, the size variation observed on the Northern blot analysis most likely results from alternative polyadenylation. 

ELOVL4 Protein and Elongation of the Very-Long-Chain Fatty Acids–Like Gene Family

The STGD3 disease gene is the fourth predicted human protein to be identified with homology to a yeast family of proteins (FEN1/Elo2 and SUR4/Elo3) involved in the elongation of very-long-chain fatty acids based on a bioinformatic search of public genomic and proteomic databases. The human genes identified in a search of the genomic databases include ELOVL1, ELOVL2, ELOVL4, and HELO1. Mouse Elovl3 exists, and presumably a human homologue will be identified. The homology of these predicted proteins is striking with conservation of the dideoxy binding site, the dilysine endoplasmic reticulum retention motif, and potential tyrosine phosphorylation sites (Fig. 6) . Each of these proteins has been predicted to have five transmembrane domains (Fig. 6) . ¹⁸  

Genomic Organization of ELOVL4

Comparison of the sequence of our cDNA clone to the genomic sequence of chromosome 6 from the Sanger Centre, enabled the unambiguous localization of the intron–exon borders of ELOVL4 (data not shown). Each of the intron–exon borders conformed to the GT/AG consensus for spice donor–acceptor sequences. ¹⁹  

Discussion

We describe a novel human gene with an ancestral 5-bp deletion in exon 6 giving rise to autosomal dominant Stargardt-like macular dystrophy in a large family distributed throughout North America. This novel gene is called elongation of very-long-chain fatty acids–like 4 (ELOVL4) because of its homology to the SUR4 family of yeast and mammalian proteins involved in the synthesis of long chain fatty acids. 

Without independent families to confirm that mutations within ELOVL4 cause disease, we screened the coding sequence and intron–exon borders of all known and identifiable genes within the critical region. The disease gene was ultimately localized within 562 kb of completely sequenced genomic DNA on chromosome 6q14. Within this region we were able to identify four genes, all of which were expressed in the retina or RPE. No DNA sequence variants were identified within the exons or their flanking sequences in our affected patients, except for the 5-bp deletion in ELOVL4. Although bioinformatics and homology to expressed sequences led to the identification of several novel genes within this region (Table 3) , we cannot exclude the possibility that one or more genes may have gone undetected. Nonetheless, the extensive genomic and proteomic resources available for eucaryotic genomes and available bioinformatic software make it unlikely that unidentified genes are located within this 562-kb region. 

The 5-bp deletion within exon 6 of ELOVL4 is predicted to cause a frameshift starting at amino acid 264 and truncated protein product at amino acid 271. The truncation would lead to the loss of 44 amino acids. The C-terminal region of the normal 314-amino-acid protein is partially conserved within members of the ELOVL protein family and contains a dilysine motif required for retention in the endoplasmic reticulum (Fig. 6) . Thus, the mutation is predicted to disrupt function of the protein. That the 5-bp deletion is not a rare polymorphism was demonstrated by its absence within 288 race–matched control chromosomes. 

The genomic localization of the STGD3 gene has been progressively refined by several investigators. ^{2 5 6 7 9 11 12 20 21} The reported localizations have all been in agreement, with the exception of unaffected individual III-4 who was reported to exclude D6S284 and telomeric markers by Kniazeva et al. ²⁰ The critical region reported herein is based on multiple affected and unaffected patients, and the data on this subject reported by Kniazeva et al. ²⁰ most likely represent a genotyping error, diagnostic misclassification, or a nonpenetrant individual. This patient illustrates the difficulties in using unaffected subjects for disease localization. 

No experimental data are available on the function of the human ELOVL1, ELOVL2, or ELOVL4 genes. The human homologue of mouse Elovl3 has not been identified to date. Experimental data are available for Elovl3, which is also called Cig30, and a human gene called HELO1, with homology to ELOVL4 (Fig. 6) . Cig30 was reported to complement the phenotype of the fen1/elo2 mutant that has reduced levels of fatty acids in the C₂₀ to C₂₄ range, demonstrating the involvement of the Elovl3 protein in the elongation of very-long-chain fatty acids. ¹⁸ HELO1 was identified by Leonard et al., ²² based on homology to yeast fen1/elo2. The HELO1 protein was expressed in Saccharomyces cerevisiae 334 and was found to result in increased elongation of monounsaturated and polyunsaturated fatty acids compared with controls. ²² Based on the homology to this family of proteins, we hypothesize that ELOVL4 is part of the membrane-bound enzymatic complex that executes the four enzymatic steps in the elongation of very-long-chain fatty acids in the neural retina. ^{23 24} The mRNAs for both of these proteins were expressed in a tissue-restricted pattern, as is ELOVL4 (Fig. 5) . 

Seven hereditary retinal diseases have been localized to chromosome 6q14. ^{25 26 27 28 29 30 31} Each of these diseases is within a 30-cM region on chromosome 6q14 between coordinates 80.34 and 111.17 cM. Based on our expression data (Table 3 and unpublished) a large number of genes expressed in the retina and/or RPE are potential candidate genes for these and other hereditary ocular disorders. The evolutionary bases for this chromosomal region with a high density of retinal disease genes are unknown. 

Identification of a mutation in ELOVL4 as the cause of autosomal dominant Stargardt-like macular dystrophy implicates fatty acid biosynthesis in the pathogenesis of macular dystrophies and degenerations for the first time. The essential dietary α-linolenic fatty acid is converted into arachidonic acid (20:4n-6) and docosahexaenoic acid (22:6n-3) by the fatty acid chain elongation system. ³² Docosahexaenoic acid accounts for 33% of the fatty acid content of human photoreceptor outer segments and the lipid environment of the outer segment influences photoreceptor function. ^{33 34 35 36 37 38} These data are consistent with an important role for the fatty acid chain elongation system in retinal function and disease. 

Recently, the results of a prospective study examining the hypothesis that ARMD is influenced by dietary lipids showed a positive association between total fat consumption and development of ARMD with visual loss. ³⁹ This study and another have reported a negative association between consumption of fish and ARMD. ^{39 40} Although these results lead to the hope that the incidence or severity of macular degeneration may be decreased by dietary modulation, the observation that the dietary precursor to docosahexaenoic acid (linolenic acid) appears to explain the majority of the risk for macular degeneration ³⁹ demonstrates the need for a better understanding of retinal fatty acid metabolism before making clinical recommendations to patients. 

Appendix AA

Database Accession Numbers

ELOVL4 (AY037298), 234P15.C (AF391300), 234P15.A (AF391303), 234P15.B (AF391299), 474L11.A (AF391304), 474L11.B (AF391310), 351K21.A (AF391311), 134M13.A (AF391312), 134M13.B (AF391313), 472A9.A (AF391314), 501M23.A (AF391301), 501M23.B (AF391302), 501M23.C (AF391298), 551A13.C (AF391315), 551A13.A (AF391317), 1007B16.A (AF391316), 1007B16.B (AF391318), 411F9.A (AF391319), 411F9.B (AF391320), 424E5.A (AF391321), 136A11.A (AF391322), 75K24.A (AF391309), 75K24.B (AF391305), 159G19.A (AF391306), 357D13.A (AF391307), 357D13.B (AF391308), 130P1.A (AF391323), 260P22.A (AF391324). GenBank is provided by NCBI, Bethesda, MD, and is available at http://www.ncbi.nlm.nih.gov/ 

 Supported in part by Grant EY12699 from the National Institutes of Health (AOE, LAD), Career Development Awards from Research to Prevent Blindness and the Foundation Fighting Blindness (AOE), and unrestricted departmental funds from Research to Prevent Blindness (University of Texas Southwestern and Wills Eye Hospital). The Schollmaier Foundation, Fort Worth, Texas; the Anne Marie and Thomas B. Walker, Jr. Fund for Age-Related Macular Degeneration, Dallas, Texas; and the Walter Center for Macular Degeneration, Dallas, Texas provided additional support at University of Texas Southwestern. The Henry and Corinne Bower Laboratory for Macular Degeneration; the Elizabeth C. King Trust; the estates of Margaret Mercer, Harry B. Wright, and Martha W. S. Rogers; the Association for Macular Diseases; and Macular Degeneration International, all of Philadelphia, Pennsylvania, provided additional support at Wills Eye Hospital. LAD is the Thomas D. Duane Professor of Ophthalmology, Wills Eye Hospital and Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania.

 Submitted for publication March 26, 2001; revised May 25, 2001; accepted June 5, 2001.

 Commercial relationships policy: N.

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked“ advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Figure 1.

 

Color photograph of the retina of a 52-year-old family member with autosomal dominant Stargardt-like macular dystrophy, showing RPE atrophy, subretinal flecks, and temporal pallor of the optic nerve.

Table 1.

 

Meiotic Breakpoint Mapping of Autosomal Dominant Stargardt-like Macular Dystrophy

Marker	Patients*
		B1001 (A)	B1025 (A)	B2003 (A)	S93 (A)	S110 (A)	B3015 (A)	B2078 (A)	B2017 (A)	B2022 (N/17)	S111 (N/29)
D6S430	X	X	X	X	X			D	D
D6S313	U	U	X	X	X			D	U	D
D6S1681	X	X	X	X	X			D	D	D
D6S280	U	U	D	X	X			D	U	D
D6S1596	D	U	D	X	X			D	D	D
D6S1659	D	D	D	U	X			D	U	D
D6S406	D	D	D	X	X			D	D	D
D6S1622	U	U	D	D	X			D	D	D
D6S456	D	D	D	D	U	D	D	D	U	U
234P15.C					D	U			D	D
234P15.A					U	U			U	U
234P15.B					U	U			U
D6S1589	D	D	D	D	D	D	D	U	U	D
474L11.A					D	D			D	D
474L11.B					U	D			U	U
351K21.A					D	D			D	D
134M13.A					U	U			U
134M13.B					U	U			U
472A9.A					D	D			D	D
D6S1625	D	D	D	D	D	U	D	U	U	D
501M23.A					U	U			U	U
501M23.B					U	U			U	U
501M23.C					U	U			U	U
551A13.C					U	D			U	D
551A13.A					D	D			X	D
1007B16.A					U	U			U	U
1007B16.B					U	U			U	U
411F9.A					D	D			X	X
411F9.B					D	D			X	X
424E5.A					D	U			X	U
136A11.A					U	D			X	U
D6S284	U	U	D	U	D	U	U	U	U	U
D6S286	U	U	D	D	U	D	U	U	X	U
D6S460	D	U	D	D	D	D		D	X	X
75K24.A					U	D			U	U
75K24.B					U	U			X	U
159G19.A					D	D			U	X
357D13.A					U	U			U	U
357D13.B					D	D			X	X
130P1.A					D	U			X	X
260P22.A					D	X			U	X
D6S1707	U	U	U	D	D	X	D	U	U	X
D6S463	U	U	U	U	U	X		U	U	U
D6S1646	U	U	D	D	D	U		U	U	X
D6S445	D	D	U	D	D	U	D	D	X	U
D6S1652	D	D	D	D	D	U	U	U	U	X
D6S1634	D	U	D	D	D	U	X	D	U	X
D6S1609	D	D	D	D	D	X	U	D	X	U
D6S1627	D	D	D	D	D			D	X	X
D6S1601	U	U	D		D			U	X	X
D6S1644	U	U	U	D	D			X	U	U
D6S1613	D	D	U	D	D			X	X	X

 Genotypes were not determined if table cells are empty. Shaded region is excluded based on informative recombinant markers. Marker order is centromeric to telomeric and based primarily on genomic sequence and mapping data from the Sanger Centre. D, informative alleles from the disease haplotype; U, uninformative alleles; X, informative alleles from haplotypes not associated with disease.

*  Subjects are identified as affected (A) or normal (N)/age at examination.

Table 2.

 

New Polymorphic Dinucleotide (AC)_n Short Tandem Repeat Markers

Name*	Forward Primer	Reverse Primer	Product Size (bp)	Observed Heterozygosity
234P15.C	CAAGCTGGCTGGTGTTTGTA	TCCTCAGTCAACAACTCCGC	162	0.90
234P15.A	CTGGAACCCCATCCCTATTT	CTATTTGAAAGGGCAGGAACT	169	0.63
234P15.B	CAGCCAAATTTTCTGGTCTGA	ATGCAAAAAGACGCAGAGAT	170	0.78
474L11.A	GGCAAGGAGGAGAATTGCTT	TTCGATATTTGCCCTGTTGA	156	0.78
474L11.B	CCACAGCTGGCTCTTACACA	TTTTATCTCCCACTGCACCC	208	0.87
351K21.A	AAGGATAAGAAAAATGAGCATTGA	ACTTCCCAATAAGCCAAGGG	168	0.76
134M13.A	GCCTGGTGGCTGCATATACT	ATGACATTCTGGGCCAGTTC	184	0.46
134M13.B	CACCTGGTTGCTCTTCCCTA	CTTGAGGCCAGGAATTTGAG	203	0.40
472A9.A	CAGGAAAATTTCACACTTTTCACA	TTTGGGTCTCTTTCTCTCCG	187	0.75
501M23.A	GCTGCCAAAAACCCTAATGA	TTCTTGCAGAATTGGCCTCT	194	0.90
501M23.B	AGGCAGAAAATTTCACTAACAGA	GCTCTTGGATTTTCCATCTCC	177	0.57
501M23.C	TGGCTAGACATGTGCATGAAA	TGCATTCCAGCCTGAGAG	172	0.78
551A13.C	TGAATGGAGCAATAAGTGCAA	TCCACAGTACCATCCTGGGT	182	0.71
551A13.A	CTCTCCCCACAAAACCCTTC	ACCCTTCCTCGGAAAAGAAA	141	0.76
1007B16.A	CCCCAGAGAAACAGCCATTA	TTTGGCATCTGAAGGAGGTC	161	0.50
1007B16.B	TGCATGAGCATGAACCAAGT	CCAGAAAGGAATTTGCATTG	203	0.31
411F9.A	TCTCTTTTCTCCATATTCTTGCTAT	TCAAGTGTAGACATACAAGTTTTCAA	197	0.65
411F9.B	ATGAGAACAGGGCTTGAGGA	ACATGTGTGTTTCTGGGTGC	206	0.82
424E5.A	CCATTCACATGTTATTTGCTGAAA	CACACCAGTGAACAACTAAGTAAACA	195	0.61
136A11.A	TTCCCCTCAGATTTCCATTG	ACTCCTGCCACCTGTCAGTC	204	0.73
75K24.A	AACGTCTGAGTGAACCTCTTGA	TCCATTCCATCTTGACTCCA	182	0.87
75K24.B	TGTGGTTTAGGCCTTTAGATTGA	CAGCACTGAACACTTCTGCTTT	195	0.83
159G19.A	GTGGAAGTGCCTGTTTCCTC	TAGGCTAAATGTCCGGTGCT	178	0.88
357D13.A	TTGGGAGTCTCAGGTGGAAG	GAAAGACATTTAAATTCCATCCAAA	196	0.66
357D13.B	TGGTTTCATAGCACCAAAATG	TGAAGAACCAAGTGAGCAAGAA	184	0.85
130P1.A	TGAAGAACCAAGTGAGCAAGAA	TGGTTTCATAGCACCAAAATG	194	0.75
260P22.A	ACAGAGACCTACCCTGTGCC	CACACCTGGTTGAGACCAAA	195	0.76

*  The primers are named after the P1 artificial chromosome (PAC) within which they are located (e.g., 234P15) in the order they were studied (e.g., A, B, C). Searching the PAC sequence for the oligonucleotides used for amplification can identify the location of the markers.

Figure 2.

 

Genomic structure of critical region containing the autosomal dominant Stargardt-like macular dystrophy gene (ELOVL4). The larger critical region based on affected patients extends from D6S1622 to 260P22.A (Table 1) . Using unaffected patients, a smaller critical region was defined between 551A13.A and 260P22.A (Table 1) . A previously reported unaffected patient enabled further refinement to between D6S460 and 260P22.A. ^{11 12} (▪), Predicted CpG islands; (○), pseudogenes.

Table 3.

 

Genes Within the Critical Region Based on Affected with Recombinant Marker Patients

Gene Name	Identifying Information (Accession Numbers)	Number of Exons	Expression and Mutation Scanning*	Sequence Variants Between Subjects and Published Sequence in GenBank
COL12A1	NM_004370	65	Not expressed in retina; expressed in RPE; excluded by unaffected meiotic recombinant	Not screened
COX7A	NM_001864	4	Not expressed in retina or RPE; excluded by unaffected meiotic recombinant	Not screened
dJ234P15.3	Unnamed gene within PAC HSJ234P15 (AL080250)	7	Expressed in retina and RPE; all exons sequenced; excluded by unaffected meiotic recombinant	Intronic SNP: C/T at positon 77601 in AL080250
SSP1	AF196304	24	Expressed in retina and RPE; excluded by unaffected meiotic recombinant	Not screened
MYOVI	U90236 NM_004999—Splice variant	34 32	Expressed in retina and RPE; exons 1–7, 9, 11, 13–34 sequenced; excluded by unaffected meiotic recombinant	Intronic SNPs: A/T at position 110771 of AL109897 A/T at position 116611 of AL109897 C/T at position 11303 of AL136093 G/A at position 28771 of AL136093 C/T at position 61507 in AL136093
IMPG1	AF047492	17	Expressed in retina; all exons sequenced; excluded by unaffected recombinant	None observed
stSG30792	EST	No information	Expressed in retina; excluded by unaffected recombinant	Not screened
HTR1B	NM_000712	1	Expressed in retina and RPE; all exons sequenced; excluded by unaffected recombinant	5′ UTR SNP: G/T at position 3420 of AL049595; 3′ UTR SNP: A/G at position 4861 of AL049595; 3′ UTR SNP: C/T at position 5120 of AL049595
SG67324	EST	No information	Expressed in retina and RPE; excluded by unaffected recombinant 11	Not screened
Unnamed protein	AK000712	13	Expressed in retina and RPE; all exons sequenced; excluded by unaffected recombinant 11	Intronic SNP: C/T at position 30991 of AL356776; CDS SNP: T/C at position 1011 in AK000712 (exon 9; no change in predicted amino acid at codon 271)
TRIP7	L40357	>6	Expressed in retina and RPE; six known 3′ exons screened; excluded by unaffected recombinant 11	None observed
75K24.1	Unnamed gene within PAC HS75K24 (AL035700)	≥3	Expressed in retina and RPE; all known exons sequenced; potential unknown centromeric exons; excluded by unaffected recombinant 11	None observed
ELOVL4	AF277094	6	Expressed in retina and RPE; all known exons sequenced; cDNA clone sequenced	CDS 5-bp deletion in exon 6
TTK	M86699	22	Expressed in retina and RPE; all exons sequenced	Intronic SNPs: C/T at position 79371 of AL133475 A/T at position 79380 of AL133475 G/A at position 79683 of AL133475 A/G at position 82950 of AL133475 G/A at position 108928 of AL133475
BCKDHE1	NM_000056	11	Expressed in retina and RPE; all exons sequenced	Intronic SNPs: G/A at position 25398 of AL138732 G → A at position 3005 of AL049696 A → T at position 1424 of AL049696

 SNP, Single nucleotide polymorphism; PAC, P1 artificial chromosome; CDS, coding sequence; UTR, untranslated region.

*  The human RPE preparations may contain small amounts of photoreceptor-derived or illegitimate transcripts that can be easily detected by RT-PCR.

Figure 3.

 

DNA sequence from exon 6 of ELOVL4 in unaffected (left) and affected (right) family members showing a heterozygous affected patient. Registration of the two DNA sequences in the affected patient demonstrates deletion of the 5-bp segment AACTT.

Figure 4.

 

Sequence of a cDNA clone for ELOVL4 isolated from a retinal cDNA library using ESTs as probes (GenBank accession AY037298). The predicted protein sequence is illustrated along with the exon boundaries (arrows). The predicted effect of the 5-bp deletion (bold and underlined sequence) on the primary structure of the ELOVL4 protein is shown under the wild-type sequence. Four putative sp1-binding domains are underlined in the promoter region obtained from the Sanger Centre (the first six rows of sequence). The translation start (ATG) and stop (TAA) codons are bold and underlined, as are putative polyadenylation consensus sequences. The differences in the start of transcription and three DNA sequence changes in the 3′ untranslated region between this clone and previously described sequence data from RT-PCR products ¹¹ are shown in bold.

Table 4.

 

Primer Sets for Mutation Scanning of ELOVL4

Exon	Forward Primer	Reverse Primer	Size
1a	ctctgggtctccgctttct	gaagtcagcggctttacctg	(70)40(17)
1b	gagccgggtagtgtcctaaa	gagcgaggatggggaagt	(0)82(30)
2a	ttaggaaattaagttgaaacatcttg	aggttctcggtccttcatcc	(97)116(0)
2b	tgtgtggctgggtccaaa	tgatggttttacacattctcattt	(0)112(75)
3	ttgtgtttttaatgctgtgtttacta	ggggcctataaaaatcaaacc	(61)81(57)
4a	tttggtgtatataacacgctttcc	ccaccacaaggtaaacatcg	(34)141(0)
4b	ttgagtatttggacacagtgttttt	tgcaattaaacgcaagcagt	(0)132(40)
5	catctcagtggcttactgcct	ccagaagaaactttggaagca	(66)128(31)
6	tgtcaacaacagttaaggccc	tgttttgtgctgtcatttctgtt	(27)278(29)

 Exons 1, 2, and 4 are divided into two segments. The size column provides the base pairs of 5′ flanking intronic sequence, coding sequence, and 3′ flanking intronic sequence inclusive of the primers in the following format: (5′ flanking)coding(3′ flanking). There are 99 bp of overlap for exon 1, 40 bp for exon 2, and 101 bp for exon 4 between the two primer sets.

Figure 5.

 

Northern blot analysis of human retina, RPE, and kidney, demonstrating tissue-restricted expression of ELOVL4. Total RNA (10μ g) was loaded onto each lane, and the cDNA clone described in Figure 4 was ³²P labeled and used as a probe.

Figure 6.

 

Multiple protein sequence alignment of the human and mouse predicted protein products of the elongation of the very-long-chain fatty acid–like gene family. Each of these gene products has homology to the SUR4 gene family involved in elongation of fatty acid biosynthesis in yeast. The amino acid sequence resulting from the 5-bp mutation is shown italicized.

The authors thank the patients and members of their extended families for continued support and participation in this research.