Distribution of Organic Anion-Transporting Polypeptide 2 (oatp2) and oatp3 in the Rat Retina

Abstract

purpose. To examine the expression of multifunctional Na⁺-independent organic anion-transporting polypeptides, termed oatp1, oatp2, and oatp3, involving the transport of thyroid hormone in the rat retina at the protein and mRNA levels.

methods. Northern blot analysis was performed using oatp1, -2, and -3 cDNAs. Reverse transcription–polymerase chain reaction (RT-PCR) was also performed using gene-specific primers for oatp1, -2, and -3. mRNA distribution of these oatps in the rat retina was examined by in situ hybridization. Western blot analysis and immunohistochemistry were also performed by raising specific antibodies against oatp2 and -3.

results. Northern blot analysis showed that the mRNAs for oatp2 and -3 were expressed in the rat retina and retinal pigment epithelium (RPE). Amplified cDNA products by RT-PCR for oatp2 and -3 were also detected in the rat retina-RPE. In contrast, no specific band for oatp1 was detected by Northern blot analysis or RT-PCR. By in situ hybridization, oatp2-specific mRNA signals were seen in the RPE and inner nuclear layer, whereas the oatp3 mRNA signal was localized to the ganglion cell. At the protein level, a single band for oatp2 and -3 proteins was detected in the rat retina-RPE by Western blot analysis. Immunohistochemistry revealed that oatp2 immunostaining was predominantly expressed at the apical surface of the RPE. Weak immunostaining for oatp2 was also seen in the inner nuclear layer and the ganglion cell layer. In contrast, apparent immunostaining for oatp3 was seen in the nerve fiber layer, ganglion cell layer, inner plexiform layer, and outer aspect of the inner nuclear layer. In addition, oatp3 immunostaining was detected predominantly in the optic nerve fiber.

conclusions. These results reveal that oatp2 is localized mainly in the RPE, suggesting a role for organic anion transport in this specialized ocular tissue. In contrast, oatp3 is localized mainly in optic nerve fibers, suggesting that oatp3 is a specific transporter in the visual nervous system. In conclusion, these data suggest that oatp2 and -3 may be involved in the transport of thyroid hormone in the rat retina.

A homeostatic system controls the fluid environment in the eye and keeps its chemical composition relatively constant compared with that of plasma. ¹ One mechanism for this regulation is the inner blood–retinal barrier (BRB), which selectively transports chemical substances through capillary endothelial cells. The second essential component is the outer BRB, which secretes to or uptakes from the retina-specific chemical substances. The outer BRB is composed of retinal pigment epithelial (RPE) cells connected by tight junctions. An effective tight junction restricts solute uptake across the paracellular pathway and makes transcellular routes necessary for the uptake of larger organic solutes into the retinal tissue. Although passive diffusion can account for the retinal penetration of many nonionic very lipid-soluble substances, glucose, amino acids, and various hormones require a carrier-mediated translocation system across the plasma membrane of the BRB. ^{1 2 3}  

Recently, we and another group have isolated cDNAs for multifunctional Na⁺-independent organic anion transporting polypeptides, termed oatp1, ⁴ oatp2, ^{5 6} and oatp3, ⁵ from the rat liver, ⁴ retina, ⁵ and brain. ⁶ These transporters are involved in the transcellular movement of amphipathic compounds in many tissues, including brain, liver, and kidney. ^{5 6} To date, six oatp isoforms have been identified. ^{4 5 6 7 8 9} Oatps are membrane proteins with 12 putative membrane-spanning domains and play a role in Na⁺-independent transport. 

oatp1 accepts a broad range of amphipathic compounds, including bile acid, steroids and their conjugates, organic anionic dyes, leukotriene C₄, peptidemimenic drugs, and even certain organic cations. ⁴ oatp1 is localized in the basolateral membrane of hepatocytes, brush border S3 segment of the kidney, and apical plasma membrane of the choroid plexus. ^{4 6 7} oatp2 is widely expressed in the neuronal cells of the central nervous system ^{5 6} and is also expressed in both the blood–brain barrier (BBB) endothelium and apical choroid plexus epithelial cells. ⁷ In a previous study, we first observed that oatp2- and -3-cRNA–injected Xenopus oocytes show significant uptake of both thyroxine (T₄) and triiodothyronine (T₃) in a dose-dependent and saturable manner. ⁵ We have suggested that oatp2 and -3 are functional transporters involved in the transport of thyroid hormones in the brain and retina. Although the developmental, structural, and functional similarities between the choroid plexus epithelium and RPE have been characterized, ^{10 11} little is known about the cellular localization of the organic anion transporting systems in the retina. In this study, we examined the expression of oatp1, -2, and -3 in the retina, and in this report we discuss its function in this specialized tissue. 

Materials and Methods

Animal Procedures

All experiments were performed on 8-week-old male Sprague-Dawley rats (Charles River Japan, Inc., Yokohama, Japan) weighing 200 g each and kept under standard conditions. Rats were killed with a lethal dose of pentobarbital sodium. All animal procedures were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 

Northern Blot Analysis

Animals ware killed as described, and four eyes were immediately enucleated. The major part of the retina was detached from the eye, leaving the RPE attached to the choroid. The RPE was then scraped from the choroid with a razor blade. The major part of the retina and RPE were homogenized together. Total RNA was isolated from the homogenized retina-RPE using an extraction agent (TRIzol; Gibco BRL, Grand Island, NY). Poly(A)⁺ RNA was isolated from 500 μg retina-RPE total RNA, using a poly(A)⁺ isolation kit (Takara, Shiga, Japan). Twenty micrograms of retina-RPE total RNA (for oatp1 and -2), 2 μg poly(A)+RNA (for oatp3) from rat retina-RPE, and 20 μg total RNA from rat liver (positive control) were isolated and electrophoresed in a 1.0% denaturing agarose gel and transferred onto a nylon membrane. Hybridization was performed with a ³²P-labeled SmaI-EcoRI cDNA fragment of the 3′ noncoding region of oatp1 ⁴ (GenBank accession no. L19301; GenBank is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD, and is available at http://www.ncbi.nlm.nih.gov/genbank), an HincII-NotI cDNA fragment of the 3′ noncoding region of oatp2 ⁵ (GenBank accession no. U95011), and an SmaI-SmaI cDNA fragment of the 3′ noncoding region of oatp3 ⁵ (GenBank accession no. AF041105), in a hybridization buffer containing 50% formamide, 5× SSC, 5× Denhardt solution, and 1% SDS at 42°C overnight. The hybridized membranes were then washed in 0.2× SSC and 1% SDS at 65°C for 1 hour and exposed to x-ray film at −80°C for 3 hours overnight. To avoid cross-hybridization each probe used in this study had less than 48% identity with any member of the organic anion transporter family. The probes were later stripped from the membranes and again hybridized with a rat β-actin ³²P-labeled probe as a control for mRNA quality. 

Reverse Transcription–Polymerase Chain Reaction

Reverse transcription was performed using a kit (Superscript RT; Gibco BRL) according to the manufacturer’s instructions. Specific primer sets for RT-PCR are shown in Table 1 . After RT, PCR amplification was performed according to the following parameters: 94°C for 3 minutes, followed by 94°C for 45 seconds, 57°C for 1 minute, and 72°C for 2 minutes for 35 cycles, with a final cDNA-elongation step at 72°C for 10 minutes. PCR products were electrophoresed in a 1% agarose gel, transferred onto a nylon membrane and subsequently hybridized with a ³²P-labeled fragment of oatp1-, oatp2-, and oatp3-specific cDNA probe, respectively. The PCR product was subcloned and sequenced, to confirm the identity of the fragment. 

In Situ Hybridization

For in situ hybridization, an HincII -NotI cDNA fragment of oatp2 ⁵ and an SmaI-SmaI cDNA fragment of oatp3 ⁵ were subcloned into a vector (pBluescript; Stratagene, La Jolla, CA). Antisense and sense RNAs were synthesized by T7 and T3 RNA polymerase, respectively, using digoxigenin (DIG)-labeled uridine triphosphate (UTP; Roche Molecular Biochemicals, Mannheim, Germany). The resultant RNAs were hydrolyzed to make approximately 150-nucleotide fragments. The frozen retinal sections were fixed with 4% paraformaldehyde and incubated with DIG-labeled probe in a hybridization solution (50% formamide, 2× SSC, 10 mM Tris-HCl [pH 7.5], 1× Denhardt solution, 10% dextran sulfate, and 0.2% SDS) at 50°C for 10 hours, washed subsequently with 2× SSC containing 50% formamide at 50°C for 1 hour, treated with RNase A (20 μg/mL) at 37°C for 30 minutes, and washed with 1× SSC containing 50% formamide at 50°C for 1 hour. Blocking was performed with 0.5% blocking reagent (Roche Molecular Biochemicals) at room temperature for 10 minutes. The sections were subsequently incubated with alkaline phosphatase–conjugated anti-DIG antibody (diluted 1:500; Roche Molecular Biochemicals) at 4°C overnight. For coloration, the sections were washed three times with phosphate-buffered saline (PBS) for 5 minutes and then immersed in a coloring buffer (250 mM Tris, [pH 9.5], 100 mM NaCl, 50 mM MgCl₂) for 5 minutes and stained using a nitroblue tetrazolium–5-bromo-4-chloro-3-indoyl-phosphate NBT-BCIP kit (Roche Molecular Biochemicals) in coloring buffer at room temperature for approximately 2 hours. The reaction was stopped with PBS and the sections counterstained with methyl green. As a control, hybridization was also performed using the sense probe. 

Preparation of Rabbit Antibodies

Peptides containing 13 amino acids (LGEKESEHTDVHG, position 644-656) at the carboxyl-terminus of rat oatp1, ⁴ 12 amino acids (CTEVLRSKVTED, position 650-661) of oatp2, ^{5 6} and 9 amino acids (KITVKKSEC, position 643-651) at the carboxyl terminus of rat oatp3 ⁵ were synthesized. These peptides were linked to the maleimide-activated keyhole limpet hemocyanin (KLH; Pierce, Rockford, IL). The KLH-linked peptide (1 mg/injection) was emulsified by mixing with an equal volume of Freund’s complete adjuvant and injected into female rabbits. Boost injections were performed every 2 weeks, and the animals were killed at 10 weeks. The antibodies were affinity purified using cyanogen bromide (CNBr)-activated Sepharose (CL-4B; Amersham Pharmacia Biotech, Piscataway, NJ) coupled with synthetic peptides, according to standard procedures. ^{12 13}  

Western Blot Analysis

Six rat eyes were enucleated, and the major part of the retina was detached from the eye, leaving the RPE attached to the choroid. The RPE was scraped from the choroid with a razor blade. A major part of the retina and RPE was homogenized in a buffer containing 0.23 M sucrose, 2 mM EDTA, 5 mM Tris-HCl (pH 7.5), 0.1 mM phenylmethylsulfonyl fluoride, 2 μg/mL aprotinin, 2 μg/mL leupeptin, and 2 μg/mL pepstatin A. The homogenate was centrifuged at 1000g for 15 minutes, and 7500g for 15 minutes. The supernatant was further centrifuged at 150,000g for 60 minutes at 4°C. The resultant pellet, referred to as the crude membrane fraction, was resuspended in a buffer of 0.23 M sucrose, 2 mM EDTA, 5 mM Tris-HCl (pH 7.5), and 2 mM EDTA. ¹⁴ Western blot analysis was performed with some modifications of previously reported protocols. ^{12 13} Briefly, 30 μg of crude membrane was solubilized in a sample buffer (2% SDS, 125 mM Tris-HCl [pH 7.4], 20% glycerol, 2% 2-mercaptoethanol) at room temperature for 5 minutes and then applied to a 10% SDS-polyacrylamide gel. After electrophoresis, proteins were transferred to a polyvinylidene difluoride membrane (Bio-Rad, Hercules, CA). The blots were blocked with 5% nonfat dry milk in PBS-T (80 mM NaHPO₄, 20 mM NaHPO₄, 100 mM NaCl, [pH 7.5], containing 0.1% Tween 20) at 4°C overnight and incubated with oatp1, -2, or -3 antibodies (2 μg/mL) for 1 hour at room temperature. The blots were then washed and incubated with anti-rabbit IgG conjugated with horseradish peroxidase (1:5000 dilution; Amersham Pharmacia Biotech) at room temperature for 1 hour. An enhanced chemiluminescence kit was used for detection (Amersham Pharmacia Biotech). To confirm antibody specificity, the antibody was incubated with 10 μg of the antigen peptide before use. 

Immunohistochemistry

Animals were killed as described earlier. The systemic circulation was perfused through an intra-aortic administration of 4% periodate-lysine and 4% paraformaldehyde in PBS. Whole eyes were removed and immersed in the same fixative overnight at 4°C, followed by dehydration. The eyes were embedded in paraffin wax and thin sectioned at 3 μm. To evaluate the histologic localization of the retina, sections were further stained with hematoxylin and eosin. After incubation in PBS containing 1% bovine serum albumin for 10 minutes, sections were incubated with oatp2 or -3 affinity-purified primary antibody at a final concentration of 2 μg/mL at 4°C overnight. The sections were then incubated in 0.3% H₂O₂ in methanol for the inhibition of endogenous peroxidase activities. Subsequently, the sections were incubated with a peroxidase staining kit (Envision+ Peroxidase Rabbit kit; Vector Laboratories, Burlingame, CA) for 40 minutes. The sections were washed three times with PBS and treated with diaminobenzidine (DAB) solution (0.01% 3′,3-diaminobenzidine tetrahydrochloride, Tris-HCl [pH 7.5], and 0.002% H₂O₂). In control experiments, sections were incubated with primary antibody preabsorbed with 8 μg/mL antigen peptide overnight before use. 

Results

Northern Blot Analysis and RT-PCR

mRNA levels for oatp1, -2, and -3 were examined by Northern blot analysis. A single band of approximately 3.8 kilonucleotides for oatp2 mRNA was detected in the retina-RPE and in liver, which served as a positive control (Fig. 1B ). oatp3 mRNA expression in the retina-RPE and liver samples were shown to have two hybridization bands. Estimated mRNA sizes for oatp3 were approximately 4.0 and 3.2 kilonucleotides in the retina-RPE and approximately 4.0 and 2.8 kilonucleotides in the liver (Fig. 1C) . The molecular sizes of these mRNAs are in good agreement with previously reported studies. ^{4 5 6} The two different sizes of oatp3 mRNA observed are likely to be derived from the same gene, because both bands were seen under high-stringency filter-washing conditions, using the 3′ noncoding region, which has less than 48% identity with any other organic anion transporter family member. Poly(A)⁺ RNA was specifically used to detect oatp3, because of its low level of expression in Northern blot analysis and RT-PCR. 

In contrast, oatp1 was shown not to be expressed in the retina-RPE, although two bands of approximately 4.0 kilonucleotides and 3.0 kilonucleotides were detected in the positive control, liver (Fig. 1A) . These data are consistent with those in a previous study. ⁴ The expression of β-actin was identified in all RNA samples. After Northern blot analysis, RT-PCR was performed using specific primers for oatp1, -2, and -3. The RT-PCR products were blotted and hybridized. As shown in Figure 1 , specific bands for oatp2 (Fig. 1B , arrow) and oatp3 (Fig. 1C , arrow) were detected in the retina-RPE and liver. Even by RT-PCR, no oatp1-specific band was observed in the retina-RPE (Fig. 1A) . To further characterize the RT-PCR product, the fragments were subcloned and sequenced, confirming that the amplified fragments were identical with those reported for oatp1, -2, and -3, respectively. 

In Situ Hybridization

To further identify the mRNA distribution of oatp2 and -3 in the retina, in situ hybridization was performed with samples prepared from the retina, using specific antisense riboprobes. Apparent oatp2 mRNA signals were observed in the RPE and inner nuclear layer (Fig. 2A ). oatp3 mRNA signals were also shown to be moderately distributed in ganglion cells (Fig. 2C) . No positive hybridization signal was obtained with oatp2 (Fig. 2B) and -3 (Fig. 2D) sense riboprobes, supporting the specific reactivity of the antisense riboprobes. 

Western Blot Analysis

To analyze the expression of oatp2 and -3 at the protein level, we first examined the specificity of the antibodies. As shown in Figure 3 , anti-oatp2 antibody recognized a large band in the liver (68 kDa) and a faint band in the retina-RPE (Fig. 3A , 70 kDa). The molecular weight observed for this antibody is in good agreement with a previous report. ¹³ Anti-oatp3 antibody recognized a band in the liver (70 kDa) and it also recognized a band in the retina-RPE (Fig. 3B ; 76 kDa). These bands completely disappeared when the antibody was preabsorbed with the antigen peptide (data not shown), indicating the specificity of the detected band. In contrast, no band for oatp1 was detected in the retina-RPE (data not shown). 

Immunohistochemistry

Previous work has demonstrated that oatp2 immunostaining was found in the apical surface of choroid plexus epithelial cells facing the cerebrospinal fluid within the rat brain. ⁷ A similar result was obtained in the retina using a specific oatp2 antibody. In Figure 4C , significant oatp2 immunostaining was detected in the RPE and weak immunostaining was also detected in the inner nuclear layer and ganglion cells. At a higher magnification, oatp2 immunostaining was observed in the apical surface of the RPE that faces the photoreceptor cells with microvilli (Fig. 4D) . In contrast, intense oatp3 immunostaining was detected in the optic nerve fiber (Fig. 4E) . In addition, apparent oatp3 immunostaining was seen in the nerve fiber layer, the ganglion cell layer, the inner plexiform layer, and the outer aspect of the inner nuclear layer (Fig. 4F) . However, there was no staining in the RPE for oatp3. Immunostaining was specific to oatp2 and -3, because preabsorption of the antibody with excess immunogen peptide resulted in the complete abolition of immunostaining for oatp2 (Figs. 4G 4H) and oatp3 (Figs. 4I 4J) , respectively. Figure 3A and 3B show hematoxylin and eosin–stained tissue sections. 

Discussion

Thyroid hormone plays an essential role in the neural function of the mammalian central nervous system, particularly during critical periods of its development. ^{15 16} In the eye, the absence of thyroid hormone causes serious damage to the structural development and organization of the retina. ¹⁷ The transport of thyroid hormone across the plasma membrane, which possibly determines its intracellular concentration, is followed by the activation of a nuclear T₃ receptor in the eye. ¹⁸ The RPE plays important roles in the uptake, storage, and mobilization of several substrates across the cell membrane. ¹⁹ The RPE is also the unique source of transthyretin (TTR) synthesis. ^{20 21} TTR is an important plasma transport protein for thyroid hormone and retinol. It is synthesized and secreted in the liver, the choroid plexus, and RPE. In addition, the presence of other organic anion-transporting mechanisms regulating the translocation of thyroid hormone has been suggested in cerebrocortical neurons, ^{22 23} astrocytes, ²⁴ glial cells, ²⁵ hepatocytes, ^{26 27} erythrocytes, ²⁸ and skeletal muscle, ²⁹ suggesting that they may serve to transport thyroid hormone across the BRB. ²⁰  

We have isolated and identified two organic anion transporters, oatp2 and -3, and have found that they may play a role for transport of thyroid hormone in the rat retina. ⁵ In this study, we have demonstrated that oatp2 is located mainly in the apical membrane of the RPE, suggesting that oatp2 may be the molecule responsible for transporting thyroid hormone from the circulation. In the rat brain, oatp2 has been localized to the basolateral cell pole in choroid plexus epithelial cells, whereas oatp1 has been localized to the apical plasma membrane, suggesting a role for these transporters in the transport of amphipathic substrates between the blood, brain, and cerebrospinal fluid compartment. ⁷ Accordingly, the hypothetical mechanism of thyroid hormone’s entry into the retina through the RPE is as follows: (1) Thyroid hormone leaves the choriocapillary through the fenestrate, going into the choroid extracellular matrix; (2) it then enters into the cytoplasm of the RPE cell through the basal membrane through the action of another molecule; and (3) it leaves the RPE cell through oatp2 in the apical membrane and enters into the extracellular space of photoreceptor cells. 

Moreover, oatp2 signals were also detected in the inner nuclear layer by in situ hybridization and immunohistochemistry. Although the inner nuclear layer contains cell bodies of horizontal neurons, bipolar neurons, and amacrine neurons, the significance of oatp2 expression in the inner nuclear layer has yet to be elucidated. 

In our study, oatp3 was found to be expressed in the optic nerve fiber, nerve fiber layer, ganglion cell layer, inner plexiform layer, and the outer aspect of the inner nuclear layer at the protein level. In addition, an oatp3-specific probe detected mRNA signals in almost all ganglion cells. There were several different oatp3 signals detected between the mRNA and protein levels. Because the axon of ganglion cells converge to form the nerve fiber layer and exit the eye as the optic nerve, ³⁰ our finding suggests that oatp3, once produced in the cell bodies of ganglion, may then be transported to the functional sites in their axon dendrites located from the inner plexiform to the inner limiting membrane and the optic nerve. The present findings are consistent with the anatomic organization of the nervous system in the eye. Furthermore, our results suggest that thyroid hormone is transported in the nervous system of the eye. The localization of oatp3 in the optic nerve may provide the means by which various organic anions are kept from reaching high concentrations in the optic nervous system. 

The analysis of oatp3 mRNA yielded two different sized hybridization bands in the retina and liver. Recently, we have identified several alternative splicing forms in the 3′ noncoding region of the oatp3 gene (Abe T, unpublished data, 2001). We have previously reported a study showing oatp3 mRNA size differences between mRNAs obtained from retina and the liver and kidney. ⁵ These data suggest that a splicing variation may occur in the region we detected in oatp3. 

As previously described, RPE is the unique source of TTR, which is a specific vehicle for transporting retinol as well as thyroid hormone. ^{20 21} Retinol is essential for phototransduction in the visual process and is also important for differentiation and morphogenesis of the eye. Retinol is delivered to the RPE through both the basal and apical surface, the former deriving from the circulation and the latter through the operation of the visual cycle. ³¹ Because the localization of oatp2 is similar to TTR at the RPE, it is suggested that this transporter may serve complementary functions in the cotransport of retinol as well as thyroid hormone. Further experiments to explore this possibility are necessary. 

In conclusion, the expression of oatp2 and -3 in the retina suggests that they may have a role in facilitating the transport of thyroid hormone in the eye. However, understanding the molecular biology of the oatp family has just begun, and some questions remain to be answered. Although, further study is necessary to fully characterize the distribution of oatp isoforms and to understand the intraocular cycling of thyroid hormone and other substances such as retinol, our findings may serve as a guide for the study of this unique transport system in the retina. 

 Supported in part by the Ministry of Education, Science, Sports and Culture; the Novartis Foundation; the Ono Medical Research Foundation; the Inamori Foundation; the Welfide Medical Research Foundation; the Uehara Memorial Foundation; the Nakatomi Foundation; the Japan Health Sciences Foundation; and the Osaka Cancer Research Foundation.

 Submitted for publication February 27, 2001; revised November 1, 2001; accepted November 14, 2001.

 Commercial relationships policy: N.

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked“ advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Primer Sets for RT-PCR

cDNA	Sequence (5′–3′)	Annealing Temperature	Position	PCR Product (bp)	Reference
oatp1
Sense primer	ATCAGTTTCATCTACTCACTTACAGCC	57°C	1644–1670	1025	4
Antisense primer	AGAAACAGGAAATGACACAGGAGTGAG		2643–2669
oatp2
Sense primer	GAGTACCTTCTGTCTTTCCTTAGCTA	57°C	1407–1432	1221	5
Antisense primer	AACTAACGCAATCTGGCTTAACCAAG		2603–2628
oatp3
Sense primer	CGCTTGGGATTGGATTACATGC	57°C	1831–1852	611	5
Antisense primer	ATGAGACAGTGGCCTTTGGAGA		2421–2442

Figure 1.

 

Northern blot analysis and RT-PCR of oatp1, -2, and -3. RNA (20 μg) for oatp1 (A) and oatp2 (B) and 2 μg poly(A)⁺ RNA for oatp3 (C) from (lane 1) rat retina-RPE and 20 μg total RNA from (lane 2) rat liver were isolated and electrophoresed with a 1.0% denaturing agarose gel and then transferred to a nylon membrane. Specific bands for oatp2 (B, arrow) and -3 (C, arrow) were detected in retina-RPE. Aβ -actin probe was used to confirm the quality of the mRNA. RT-PCR amplification was performed.

Figure 2.

 

In situ hybridization of oatp2 and -3 mRNA in the rat retina. In situ hybridization, using specific riboprobes prepared from the noncoding regions of oatp2 and -3 cDNA, demonstrated the existence of oatp2 and -3 mRNA in the retina. Apparent oatp2 signals were observed in the RPE and inner nuclear layer (A). oatp3 signals were localized to ganglion cells (C). No staining was seen, when using sense probes (B) and (D).

Figure 3.

 

Western blot analysis of oatp2 and -3. Western blot analyses of rat retina-RPE and liver membrane were performed with the affinity-purified antibodies against rat oatp2 (A) and -3 (B). Crude membrane (30 μg ) was applied to 10% SDS-polyacrylamide gel. Specific bands for oatp2 (70 kDa) and -3 (76 kDa) were detected in retina-RPE.

Figure 4.

 

Immunohistochemical localization of oatp2 and -3 in the rat retina. Hematoxylin and eosin–stained tissue sections of rat retina (A, B). oatp2 immunostaining was seen in the RPE (C). The inner nuclear layer and ganglion cells were also weakly immunostained. At higher magnification, oatp2 immunostaining was observed in the apical surface of the RPE that faces photoreceptor cells (D). oatp3 immunostaining was seen abundantly in the optic nerve fiber layer (E). Apparent immunostaining was seen in the nerve fiber layer, ganglion cell layer, inner plexiform layer, and outer aspect of the inner nuclear layer (F). (G, H) Controls for oatp2. (I, J) Controls for oatp3.