Mutation Analysis of the Carbohydrate Sulfotransferase Gene in Vietnamese with Macular Corneal Dystrophy

Abstract

purpose. Mutations in a new carbohydrate sulfotransferase gene (CHST6) encoding corneal N-acetylglucosamine-6-sulfotransferase (C-GlcNac-6-ST) have been identified as the cause of macular corneal dystrophy (MCD) in various ethnicities. This study was conducted to examine the CHST6 gene in Vietnamese with MCD.

methods. Nineteen unrelated families, including 35 patients and 38 unaffected relatives were examined clinically. Blood samples were collected. Fifty normal Vietnamese individuals served as control subjects. Genomic DNA was extracted from leukocytes. Analysis of the CHST6 gene was performed with polymerase chain reaction and direct sequencing. Corneal buttons were studied histopathologically.

results. A slit lamp examination revealed clinical features of MCD with gray-white opacities and stromal haze between. On histopathology, corneal sections showed positive staining with colloidal iron. Sequencing of the CHST6 gene revealed six homozygous and three compound heterozygous mutations. The homozygous mutations, including L59P, V66L, R211Q, W232X, Y268C, and 1067-1068ins(GGCCGTG) were detected, respectively, in two, one, eight, one, one, and two families. Compound heterozygous mutations R211Q/Q82X, S51L/Y268C, and Y268C/1067-1068ins(GGCCGTG) were identified, each in one family. A single heterozygous change at codon 76 (GTG→ATG) was detected in family L, resulting in a valine-to-methionine substitution (V76M). None of these mutations was detected in the control group.

conclusions. Mutations identified in the CHST6 gene cosegregated with the disease phenotype in all but one family studied and thus caused MCD. Among these, the R211Q detected in 9 of 19 families may be the most common mutation in Vietnamese. These data also indicate that significant allelic heterogeneity exists for MCD.

Macular corneal dystrophy (MCD; MIM 217800; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD) is a rare corneal dystrophy characterized by progressive stromal clouding and central corneal thinning. ^{1 2} MCD is inherited as an autosomal recessive trait and is clinically severe in pedigrees with consanguinity. The disease becomes apparent in the first decade of life, starting with a fine superficial stromal haze in the central stroma. Gradually, this opacification extends to the periphery and usually involves the entire thickness of the cornea. Multiple, irregular gray-white nodular opacities develop within the haze. The opacities are more superficial and prominent in the central cornea, but deeper and more discrete in the periphery. As a treatment, penetrating keratoplasty is performed when useful vision has been lost. 

Although clinically indistinguishable, MCD has been subdivided into three immunophenotypes (MCD types I, IA, and II) based on measurement of the serum level of sulfated keratan sulfate (KS) and an immunohistochemical evaluation of the corneal tissue. ^{3 4} Histopathologically, MCD is characterized by accumulation of glycosaminoglycans in the epithelium, Bowman’s layer, stroma, Descemet’s membrane, and endothelium, as well as within stromal keratocytes. ^{5 6}  

A gene responsible for MCD types I and II has been linked to chromosome 16 (q22). ^{7 8 9} Recently, mutations in a new carbohydrate sulfotransferase gene (CHST6) encoding corneal glucosamine N-acetyl-6-sulfotransferase (C-GlcNac-6-ST) have been identified as the cause of MCD. ¹⁰ In the subjects with MCD type I or IA, numerous missense mutations of CHST6 gene were found to be responsible (Bao W, Smith CF, Al-Rajhi A, Chandler JW, Karcioglu ZA, Akama TO, Fukuda MN, Klintworth GK, ARVO Abstract 2609, 2001). ^{10 11 12} For MCD type II, deletion and/or rearrangements in the upstream region and, recently, a missense mutation were described. ^{10 12}  

In this study, we analyzed the CHST6 gene for mutations in 19 Vietnamese families with clinical diagnosis of MCD, including 2 families affected by MCD in two consecutive generations. 

Materials and Methods

Subjects

Nineteen unrelated Vietnamese families with MCD from 12 different provinces of the northern and central regions of Vietnam were examined. The affected subjects, including 19 males and 16 females were aged from 14 to 68 (average, 37) years at time of recruitment. All had been under observation at the Department of Corneal and External Diseases, National Institute of Ophthalmology (NIO), Hanoi, Vietnam. Clinical diagnosis of MCD in our patients was based on pedigree structure and the following clinical features: bilateral ground-glass–like haze in the superficial stroma and multiple gray-white opacities with irregular borders within this hazy matrix. Blood samples were obtained from a peripheral blood vessel. Fifty normal Vietnamese subjects were the control subjects. Leukocytes were pelleted and transferred to Juntendo University. 

The study was performed according to the tenets of the World Medical Association’s Declaration of Helsinki regarding research involving human subjects. Informed signed consent was obtained from the affected and unaffected family members and from control subjects. This was a joint research project between the NIO, Hanoi, Vietnam, and Juntendo University, Tokyo, Japan, approved by the Ministry of Health of Vietnam (Agreement 10887 YT/QT) and the Ethics Committee of Juntendo University (No. 109). 

Mutation Analysis

Genomic DNA was extracted from blood leukocytes by standard procedures. ¹³ The coding region of the CHST6 gene was amplified by polymerase chain reaction (PCR) using each pair of primers and PCR conditions by Akama et al. ¹⁰ except for the middle coding region, where primers 743F (5′-GCAGACCTTCCTCCTCCTCT-3′) and 1578R (5′-TGAGACTGAGCCCAGTGAAG-3′) were used. The upstream regions of the CHST6 gene (regions A and B) were analyzed for deletion and replacement mutation by PCR. ¹⁰ The promoter region (326 bp upstream from start codon) was amplified with a pair of primers: forward/reverse (GGTAATGTGGGTAGGTAGAAC/AGAAAGAGGAGGAGGAAGGTC). For direct sequencing, PCR products were purified with a kit (High Pure PCR Purification; Roche Diagnostics GmbH, Mannheim, Germany) ^{14 15} and then the terminator reaction was performed with a DNA sequencing kit (Big Dye Terminator Cycle Sequencing, Ready Reaction; Applied Biosystems, Foster City, CA). Sequencing was performed in an automated DNA Sequencer (model 377; Applied Biosystems) in both sense and antisense strands. Nucleotide sequences were compared with the published cDNA sequence of the CHST6 gene (GenBank accession number AF219990; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD). 

Pathologic Study

Corneal buttons obtained from 32- and 45-year-old patients at keratoplasty were fixed in 10% buffered formaldehyde solution for routine paraffin wax embedding and light microscopy. Cross sections of each button were prepared and stained with colloidal iron. Unfortunately, we could not perform an assay of KS in serum. 

Results

Slit lamp examination of the affected individuals showed superficial stromal cloudiness studded by irregular rounded gray-white opacities in both the central and peripheral cornea (Fig. 1A) . The corneal opacities were deep, involving Descemet’s membrane and the endothelium. In some advanced cases, they enlarged and coalesced, taking on the appearance of a corneal scar, with overlying surface irregularity. Although the age of onset was not determined with certainty, the visual disturbance was usually noticed in the first decade of life. Consanguinity was not a feature in any family. Almost half of the patients with MCD in this study were members of families with more than one affected individual. Of these, the pedigree of family V1 showed numerous individuals affected with MCD (Fig. 1B) . 

Histopathologic sections of two corneal specimens showed the abnormal corneal accumulations in subepithelial area, stroma, Descemet’s membrane, and endothelium stained positively with colloidal iron, indicating glycosaminoglycans of these deposits (Fig. 1C) . 

Sequencing of the CHST6 gene within the coding region revealed nine different mutations in 19 unrelated families (Table 1) . Of these, six changes were homozygous and were detected in most of the families. The nucleotide changes: T868C at codon 59 (CTC→CCC), G888C at codon 66 (GTC→CTC), G1324A at codon 211 (CGG→CAG), G1388A at codon 232 (TGG→TGA), and A1495G at codon 268 (TAC→TGC) were identified, resulting, respectively, in a leucine-to-proline (L59P), a valine-to-leucine (V66L), an arginine-to-glutamine (R211Q), a tryptophan-to-stop (W232X), and a tyrosine-to-cysteine (Y268C) substitution (Figs. 2a 2B 2C 2D 2E) . In two families, an insertion of 7 bp between nucleotides 1067 and 1068—nt 1067-1068ins(GGCCGTG)—was identified, resulting in a frameshift after codon 125 (frameshift after 125V; Fig. 2F ). 

In addition, compound heterozygous mutations were detected in several families. In family T, two heterozygous changes: C844T at codon 51 (TCG→TTG) and A1495C at codon 268 (TAC→TGC) were identified, predicting an amino acid change of serine to leucine (S51L) and tyrosine to cysteine (Y268C), respectively (Figs. 3A 3B) . In family N, a heterozygous change, C936T at codon 82 (CAG→TAG), replacing a glutamine with a stop codon was detected, along with a G1324A change at codon 211 (CGG→CAG, R211Q; Figs. 3C 3D ). In family V2, heterozygous changes, A1495G, at codon 268 (TAC→TGC, Y268C) and nt1067-1068ins(GGCCGTG) were identified (Figs. 3E 3F) . In family L, a single heterozygous change, G918A, at codon 76 (GTG→ATG) was detected, resulting in a valine-to-methionine substitution (V76M; Fig. 3G ). 

Sequencing analysis of this family failed to detect any nucleotide change in the promoter region. Neither a replacement nor a deletion mutation was found in the upstream regions (A and B) of the CHST6 gene by PCR (data not shown). None of the mutations described earlier was detected by direct sequencing in the control population of Vietnamese origin (data not shown). 

Discussion

Macular corneal dystrophy is the least common of the classic stromal dystrophies. This disorder is more common in Iceland, however, representing the most frequent indication for penetrating keratoplasty. ¹⁶ In the present study, we collected 19 unrelated Vietnamese families with clinically diagnosed MCD. These were considered sporadic cases, because consanguinity was not recognized in any pedigree. Slit lamp examination of the affected individuals showed corneal opacities and stromal haze, characteristic of MCD, as described elsewhere. ^{12 17} Histopathologic examination of corneal buttons showed positive staining with colloidal iron, confirming clinical diagnosis of MCD. 

Sequencing analysis of the CHST6 coding region revealed nine distinct alterations of the nucleotide sequence in the patients from 19 families. Of these, six changes, T868C, G888C, G1324A, A1495G, G1388A, and a 7-bp insertion between nucleotides 1067 and 1068, were identified as homozygous. The nucleotide change results in missense mutations with modification of amino acids in the protein product (L59P, V66L, R211Q, and Y268C), causes an early stop codon (W232X), and affects the translated protein (frameshift after 125V). Two other changes: heterozygous C844T and C936T were found in association with the changes A1495G, G1324A, and 1067-1068ins(GGCCGTG), resulting in a compound of different mutations on each allele: S51L/Y268C (family T), R211Q/Q82X (family N), and Y268C frameshift after 125V (family V2). These compound heterozygous mutations could also account for MCD as a recessive disorder. A single heterozygous alteration G918A identified in family L could not be regarded as a cause of the MCD phenotype; further investigation upstream of the CHST6 gene (other than regions A and B) for deletion or replacement mutation or analysis of the other genes, such as CHST4 and CHST5, would be necessary. None of these nucleotide alterations was detected in the 50 control subjects of Vietnamese origin, indicating that these were true disease-causing mutations. Six homozygous and three compound heterozygous mutations cosegregated with the disease phenotype in each pedigree and thus caused MCD in our patients. 

The molecular basis of the manifestation of MCD has not yet been elucidated. It has been shown that the decrease in C-GlcNac-6-ST activity in the cornea of patients with MCD may result in the formation of poorly or nonsulfated KS and cause corneal opacity. ¹⁸ The mutations of the CHST6 gene found in our patients infer an essential role of C-GlcNac-6-ST, the CHST6 protein product, in the production of normally functioning KS. Among various mutations found in Vietnamese patients, R211Q was detected at a relatively high frequency (eight families were homozygous and one family was heterozygous for the mutation). 

Although the immunophenotypes of our patients could not be subdivided, most genetic alterations identified herein were missense mutations. Those were described in patients with MCD type I or IA. In our patients, all mutations were detected within the middle coding region amplified with primers 743F and 1578R. Therefore, using this pair of primers may facilitate mutation screening of patients with MCD. The mutations identified in Vietnamese are completely different from the ones reported previously in Asians (Japanese) ¹⁰ or whites (British and Icelandic). ^{11 12} Together with previous reports, ^{10 11 12} our data indicate that significant allelic heterogeneity exists for MCD. 

 Supported by Grants-in-Aid B05454477 and B07457417 for Scientific Research from the Ministry of Education, Culture, and Sport, Tokyo, Japan.

 Submitted for publication January 13, 2003; revised February 27, 2003; accepted March 6, 2003.

 Disclosure: N.T. Ha, None; H.M. Chau, None; L.X. Cung, None; T.K. Thanh, None; K. Fujiki, None; A. Murakami, None; Y. Hiratsuka, None; A. Kanai, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Figure 1.

 

(A) Photograph of the cornea in a patient with MCD shows irregular rounded gray-white opacities with intervening stromal haze, extending to the periphery. (B) Pedigree of family V1 showing numerous individuals affected with MCD. Open symbols: clinically unaffected members; filled symbols: clinically affected members. (✶) Members who were examined clinically; (•) members who were examined genetically. Arrow: the proband. (C) Pathologic section of MCD-affected cornea shows the abnormal accumulations in the subepithelial area, stroma, Descemet’s membrane, and endothelium, stained positively with colloidal iron.

Table 1.

 

Mutations of the CHST6 Gene Found in the Present Study

Nucleotide Change	Type of Nucleotide Change	Amino Acid Change	Families (n)
T868C	Homozygous	L59P	2
G888C	Homozygous	V66L	1
G1324A	Homozygous	R211Q	8
G1388A	Homozygous	W232X	1
A1495G	Homozygous	Y268C	1
1067-1068ins(GGCCGTG)	Homozygous	Frameshift after 125V	2
[C844T + A1495G]	Heterozygous	S51L	1
	Heterozygous	Y268C
[G1324A + C936T]	Heterozygous	R211Q	1
	Heterozygous	Q82X
[A1495G + 1067–1068ins(GGCCGTG)]	Heterozygous	Y268C	1
	Heterozygous	Frameshift after 125V
G918A	Heterozygous	V76M	1*
Total			19

Figure 2.

 

Homozygous mutations identified by sequencing of the CHST6 gene. (A) Sequence around codon 59 revealed a change of the second nucleotide at codon 59 (CTC→CCC), resulting in a leucine-to-proline substitution (L59P). (B) Sequence around codon 66 revealed a change of the first nucleotide at codon 66 (GTC→CTC), resulting in a valine-to-leucine substitution (V66L). (C) Sequence around codon 211 revealed a change of the second nucleotide at codon 211 (CGG→CAG), resulting in an arginine-to-glutamine substitution (R211Q). (D) Sequence around codon 232 revealed a change of the third nucleotide at codon 232 (TGG→TGA), resulting in a tryptophan-to-stop substitution (W232X). (E) Sequence around codon 268 revealed a change of the second nucleotide (TAC→TGC), resulting in a tyrosine-to-cysteine substitution (Y268C). (F) Sequence around codon 125 revealed an insertion of 7 bp between nucleotides 1067 and 1068—nt 1067-1068ins(GGCCGTG)—resulting in a frameshift after 125V.

Figure 3.

 

Heterozygous mutations identified by sequencing of the CHST6 gene. (A) Family T: sequence around codon 51 revealed a change of the second nucleotide at codon 51 (TCG→TTG), resulting in a serine-to-leucine substitution (S51L). (B) Family T: sequence around codon 268 revealed a change of the second nucleotide at codon 268 (TAC→TGC), resulting in a tyrosine-to-cysteine substitution (Y268C). (C) Family N: sequence around codon 82 revealed a heterozygous change of C to T at codon 82 (CAG→TAG), replacing glutamine with a stop codon. (D) Family N: sequence around codon 211 revealed a heterozygous change of the second nucleotide at codon 211 (CGG→CAG), replacing an arginine with glutamine (R211Q). (E) Family V2: sequence around codon 268 revealed a heterozygous change of A to G at codon 268 (TAC→TGC), resulting in a tyrosine-to-cysteine substitution (Y268C). (F) Family V2: sequence around codon 125 revealed a heterozygous nt1067-1068ins(GGCCGTG) change, causing a frameshift after 125V (double-wave peaks after 7-bp insertion are due to nonmatching of nucleotide sequence in two alleles). (G) Family L: sequence around codon 76 revealed a heterozygous change of the first nucleotide at codon 76 (GTG→ATG), resulting in a valine-to-methionine substitution (V76M).

The authors thank Vu Thi Minh Thu, National Institute of Ophthalmology, Hanoi, Vietnam, for valuable technical assistance.