Of Mice and Men: Tyrosinase Modification of Congenital Glaucoma in Mice but Not in Humans

Abstract

purpose. Primary congenital glaucoma (PCG) is an autosomal recessive ocular trait caused by mutations in the gene for cytochrome P4501B1 (CYP1B1). Although PCG is often considered to be fully penetrant, the disease shows 50% penetrance in some Saudi Arabian families. The familial segregation of the nonpenetrance suggests a genetic modifier. Recently, tyrosinase (Tyr) deficiency was found to worsen the drainage structure/ocular dysgenesis phenotype of Cyp1b1 ^{− / −} mice, suggesting that Tyr is a modifier of the phenotype. In the current study, tyrosinase (TYR) was investigated in human PCG.

methods. A genome-wide screen, a single nucleotide polymorphism (SNP) analysis in the TYR chromosomal region 11q13-q21, and sequencing of the TYR gene was performed with individuals from Saudi Arabian families with multiple, clinically confirmed, molecularly proven, nonpenetrant members.

results. The study outcome did not support TYR as a modifier of the PCG phenotype in this population. The sequencing data showed no TYR mutations in the nonpenetrant family members and no difference in polymorphism frequencies between nonpenetrant or fully penetrant families.

conclusions. TYR is not a modifier of the CYP1B1-associated PCG phenotype in the Saudi Arabian population.

In previous work, we showed that 94% of individuals with primary congenital glaucoma (PCG) in Saudi Arabia have homozygous or compound heterozygous mutations in CYP1B1 and that 29% of families with PCG in this population show 50% penetrance. ^{1 2 3} In these families, half of the study subjects with molecularly proven homozygous or compound heterozygous CYP1B1 mutations show no evidence of glaucoma in childhood. Some individuals also have a normal ocular examination even in adolescence and adulthood. Two of us (BAB, DPE) recently confirmed the normal phenotype in many asymptomatic and clinically normal individuals (n = 8; ages, 7–28 years old) who have identical homozygous CYP1B1 mutations (G61E) to their unequivocally affected siblings (Table 1) . Less than complete penetrance of PCG has not been reported in any other population. ^{4 5 6 7 8 9 10 11 12 13} Several possible explanations have been espoused for the reduced penetrance in this population. Perhaps the large sizes of sibships or families in Saudi Arabia contributed to the recognition of the segregation distortion, and it was merely overlooked in populations with small nuclear families. Alternatively, a potential environmental factor in Saudi Arabia protects individuals at genetic risk. Or perhaps other genetic loci decrease the susceptibility to the clinical disorder. It is unlikely that the observation has been missed in other populations because of small family sizes, since some large families studied have no nonpenetrant individuals (Bejjani BA, unpublished data, 2005). Similarly, in reports of populations geographically close to Saudi Arabia and in fact in some families in our sample from Saudi Arabia, penetrance is not reduced. These observations do not prove that there is no environmental modifier; however, it seems to make it less likely. The working hypothesis for reduced penetrance in the Saudi population invokes an independently segregating genetic locus that decreases the susceptibility to development of clinical disease. Genetic data suggest that a modifier of the PCG phenotype in this population may behave as a dominant allele. ³  

Recently, the tyrosinase gene (Tyr) was shown to modify the phenotype of Cyp1b1 ^{− / −} mice. ¹⁴ Tyrosinase deficiency exacerbated the change in angle structure–ocular dysgenesis phenotype in these mice. ¹⁴ In addition, the ocular dysgenesis in Cyp1b1 ^{− / −}, Tyr ^{− / −} mice was alleviated by the administration of oral dihydroxyphenylalanine (l-dopa) to the pregnant mothers. l-Dopa is the product of tyrosinase mono-oxygenation of tyrosine, thereby bypassing the need for Tyr. These experiments suggest that a pathway involving tyrosinase and l-dopa (or an l-dopa metabolite) participates in either the formation or the function of the anterior chamber drainage structures or functions during prenatal development. Based on these findings, we hypothesized that variation of tyrosinase in humans may modify the PCG phenotype. If this were the case, then genes or drugs affecting l-dopa levels would modify the deleterious effects of CYP1B1 mutations. Such a possibility would provide an opportunity to investigate possible therapies to reduce the incidence or severity of glaucoma in at-risk families. In the current study, we evaluated the possible role of tyrosinase (TYR) in the modification of the human PCG phenotype by linkage, single nucleotide polymorphism (SNP) analysis, and sequencing. Our data do not support TYR as a major modifier of the PCG phenotype in the Saudi population. 

Methods

Each subject, or the responsible adult on behalf of minors, signed a consent for participation in these investigations that was approved by the appropriate Institutional Review Boards for Human Subject Research in the United States and Saudi Arabia. The study research adhered to tenets of the Declaration of Helsinki. 

We performed a genome-wide screen of 97 individuals from 17 Saudi Arabian families with multiple nonpenetrant members. Fifty-eight of these 97 individuals were molecularly proven to have homozygous or compound heterozygous CYP1B1 mutations. Thirty-three of the 58 were affected, and 25 were clinically confirmed to have normal corneal diameters, normal intraocular pressures, and normal-appearing optic nerves. Eight of these 25 nonpenetrant patients underwent two independent ophthalmic examinations separated by 10 years (Table 1) . The additional 39 individuals were normal parents or siblings with one or no mutant CYP1B1 alleles. Genotyping data were generated by linkage mapping (PRISM Linkage Mapping Set; Applied Biosystems, Inc., Foster City, CA). Data were evaluated with both nonparametric and parametric linkage techniques, with susceptibility or protection, and with both dominant and recessive models (data not shown). 

SNP analysis spanning the TYR gene (Fig. 1)was realized in 96 individuals from 19 Saudi Arabian families with nonpenetrant members. These 96 individuals included 87 individuals from the same 17 families studied for the genome-wide screen plus 9 more individuals from two other nonpenetrant families. In both studies, the relative number of affected, nonpenetrant, and normal control individuals were 34%, 26%, and 40%, respectively. SNPs were chosen from the SNP database (http://www.ncbi.nlm.nih.gov/SNP/ provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD); the assays were designed with assay design software (Sequenom, Inc., San Diego, CA). Data were recorded for affected, carrier, and control individuals. 

The five exons of the TYR gene were sequenced. We selected for analysis 60 individuals with homozygous or compound heterozygous mutations in CYP1B1 from the same 19 nonpenetrant families. Thirty-three of these individuals were nonpenetrant, and 27 had full expression of the disease. In addition, 50 individuals with PCG were selected at random from 24 Saudi Arabian families that had no nonpenetrant individuals. We also studied 50 unrelated and unaffected Saudi control subjects with no family history of hereditary eye disease and 50 unaffected white control subjects. The sequences of the TYR primers are shown in Table 2 . All amplification reactions were performed with standard PCR conditions in a thermal cycler (GeneAmp PCR system 9700; Perkin Elmer, Wellesley, MA). The amplified products were purified (QIAquick PCR Purification Kit; Qiagen, Valencia, CA) and sequenced (BigDye Terminator Cycle Sequencing Ready Reaction DNA sequencing kit; ABI) in the forward and reverse directions, according to the manufacturer’s recommendations. Sequencing results were recorded on a genetic analyzer (PRISM 3100; ABI), according to the manufacturer’s recommendations. The data were analyzed (Sequencher ver. 3.1.1 software; Gene Codes, Ann Arbor, MI). 

Results

A genome-wide screen with 97 individuals from 17 Saudi Arabian families with multiple, clinically confirmed, molecularly proven, nonpenetrant members did not identify any statistically significant evidence for a cosegregating locus, making the hypothesis of a single genetic modifier locus less appealing. 

The genotype data from the genome screen previously completed were reanalyzed for the several markers that most closely flank the TYR locus on chromosome 11 at region q13-q21 (http://www.ensembl.org ¹⁵ ), D11S937, D11S901, and D11S4175 (Fig. 1A) . A targeted two-point linkage analysis confirmed the previous linkage results that no lod score was significantly positive at any of these three markers (Table 3) . The analysis of SNPs spanning the TYR gene (Fig. 1B)in 96 individuals from 19 nonpenetrant families showed no significant linkage to the TYR locus either (data not shown). 

The sequencing of the TYR gene did not show any alteration in any of the 60 individuals with homozygous or compound heterozygous mutations in CYP1B1 from 19 nonpenetrant families. We identified two coding polymorphisms, one in exon 1 (575C→A, S192Y) and another in exon 4 (1205G→A, R402Q) already described in the Mutation Database of the TYR Gene (http://www.retina-international.com/sci-news/tyrmut.htm/ provided in the public domain by Retina International’s Scientific Newsletter and maintained by Markus Preising, Molecular Genetics Laboratory. University of Regensberg, Germany). Table 4shows the observed genotype data for individuals from nonpenetrant families, fully penetrant families, Saudi control subjects, and non-Saudi control subjects. The exon 1 polymorphism showed a similar distribution of alleles in affected individuals, in their nonpenetrant relatives, in individuals from fully penetrant Saudi families, and in Saudi control subjects who do not have PCG (18.0%–22.2%; Table 4 ). This differed significantly from the non-Saudi control subjects, who had a higher frequency of the A allele (P < 10⁻⁵). The exon 4 polymorphism also showed similar distribution of alleles between affected individuals and their nonpenetrant relatives (9.1%–11.1%), although the frequency of heterozygosity for the variant is slightly higher in the fully penetrant families than in the nonpenetrant (20.0%) ones. Also, this frequency is even higher in the Saudi control subjects, who do not have PCG and in non-Saudi control subjects (38.0%–40.0%; Table 4 ). Because multiple individuals are included from some families, these are not independent samples. To adjust for this, a weighted average was generated representing one individual randomly selected from each family. These data are shown in Table 5 . The differences are not statistically significant (χ² = 6.49; 3 df ; P = 0.371). Our sequencing data do not support TYR as a major modifier of the PCG phenotype in the Saudi population. 

Discussion

The recent report of Tyr as a possible modifier for anterior segment dysgenesis in the Cyp1b1 ^{− / −} mouse provided an attractive functional candidate for a genetic modifier of PCG in humans. The PCG cohort from Saudi Arabia is a unique population because of the high prevalence of CYP1B1 mutations, probably as the result of both the high coefficient of inbreeding and large family sizes. These attributes offer an opportunity to test whether TYR is a modifier of the PCG phenotype in this population. Physical examination of many nonpenetrant individuals did not reveal any substantive difference in cutaneous or ocular pigmentation compared with their fully penetrant relatives (Fig. 2) . 

Studies of reduced penetrance in both recessive and maternally inherited deafness identified modifier genes by linkage analysis. ^{16 17} In contrast, however, we found no evidence for linkage (lod scores <+2) of TYR with the glaucoma phenotype or with the nonglaucoma phenotype within the families with incomplete penetrance. Nevertheless, it is still possible that TYR is a minor modifier in this population. TRP1 and TRP2 genes, which participate in l-dopa metabolism, are also candidates for the modification of the phenotype in PCG. The segregation of haplotypes for markers close to these genes (D3S1263 for TRP1 and D13S1241 for TRP2) showed no correlation with the nonpenetrant phenotype (data not shown). 

We identified nonpenetrant individuals in families with homozygous missense mutations (G61E), compound heterozygous mutations (G61E/R469W, G61E/D374N) and a homozygous nonsense mutation (4238del10). However, the majority of these (16 of the 19 nonpenetrant families), have the same homozygous CYP1B1 mutation (G61E). ³ This mutation produces a change in a conserved amino acid but does not interrupt the synthesis of the protein as does the knockout in the mouse. ¹⁴ In fact, most of our study subjects carried recessive missense mutations in CYP1B1, some of which have been shown to have residual enzymatic activities. ¹⁸ Because the putative molecular mechanism of interaction between CYP1B1 and TYR is not known, a modifier effect of TYR on other CYP1B1 human mutations cannot be excluded. 

It is also possible that the role of TYR in normal human eye development is different from that in the murine mouse model due to intrinsic, yet unidentified differences between mice and humans. 

The frequency of anterior segment dysgenesis and infantile glaucoma in patients with albinism, ^{19 20} the presence of an avian model of congenital glaucoma in the Albino Japanese quail (Coturnix coturnix japonica) ^{21 22} and the recent work on the mouse model ¹⁴ suggest that tyrosinase or related pigment-associated molecules play a role in trabecular meshwork or angle formation or function. The specific role(s) for these molecules in formation of the iridocorneal angle and the nature of their interaction with CYP1B1 should be refined. 

 Supported by National Eye Institute Grant R01 EY11780 (BAB). RAL is a Senior Scientific Investigator of Research to Prevent Blindness.

 Submitted for publication June 16, 2005; revised November 8, 2005; accepted February 9, 2006.

 Disclosure: C. Bidinost, None; N. Hernandez, None; D.P. Edward, None; A. Al-Rajhi, None; R.A. Lewis, None; J.R. Lupski, None; D.W. Stockton, None; B.A. Bejjani, None;

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

Clinical Examination of Eight Nonpenetrant Individuals 10 Years after Initial Enrollment

Family	Individual	Age at 2nd Examination (y)	Genotype	Phenotype	Treatment
105	105–08	12	G61E/G61E	IOP: 14/14 mm Hg; K diameter: 12/12; cornea: clear	None
	105–22	7	G61E/G61E	IOP: 19/37 mm Hg; K diameter: 13/14; cornea: clear	None; referred to KKESH for further evaluation and therapy
113	113–09	19	G61E/G61E	IOP: 27/27 mm Hg; K diameter: 12/12; cornea: clear	None
	113–13	11	G61E/G61E	IOP: 27/13 mm Hg; K diameter: 12/12; cornea: clear	None
137	137–12	28	G61E/G61E	IOP: 14/14 mm Hg; K diameter: 11.5/11.5; cornea: clear	None
	137–13	27	G61E/G61E	IOP: 22/22 mm Hg; K diameter: 12/12; cornea: clear	None
143	143–05	17	G61E/G61E	IOP: 17.3/17.3 mm Hg; K diameter: 12/12; cornea: clear	None
	143–06	15	G61E/G61E	IOP: 14/14 mm Hg; K diameter: 12/12; cornea: clear	None

Figure 1.

 

Genetic map of TYR locus on 11q13-q21. (A) Position of the genotyping markers used for linkage in 11q13-q21. Cen, centromeric side; Tel, telomeric side. (B) Position of the SNPs used for linkage in and around the TYR gene. TYR exons and the number of the exons are in blue. Bar, 10 kb.

Table 2.

 

Primer Pair Sequences Used for PCR Amplification of TYR Exons

Exon	Primer Sequences
1 - F	5′ GGTCTCAGCCAAGACATGTGA 3′
1 - R	5′ ACAGGGCACCATTTCT 3′
2 - F	5′ AACATTTCTGCCTTCTCCTAC 3′
2 - R	5′ CACAGCCTCCCAAGTAAACTG 3′
3 - F	5′ AAGAGTCTCAATACGGAA 3′
3 - R	5′ CTTAAATCACATTTGATAGGC 3′
4 - F	5′ CCTTATTTTACTTTAAAAATT 3′
4 - R	5′ GGCCTATGTTAAGCAA 3′
5 - F	5′ CCCAAGCTCTTACAGT 3′
5 - R	5′ ATGGTCTTTACAGAAAAATAC 3′

Table 3.

 

Lod Score for Markers around TYR on 11q13-q21

Marker	Parametric Lod Score* (θ)													NPL, † Score
		0.00	0.01	0.05	0.10	0.20	0.30	0.40
Dominant protective
D11S937	−1.01	−0.93	−0.66	−0.45	−0.21	−0.08	−0.02	−0.79 (P = 1.00)
D11S901	−2.31	−1.87	−1.11	−0.69	−0.29	−0.11	−0.02	−0.50 (P = 0.74)
D11S4175	−1.40	−0.91	−0.38	−0.18	−0.05	−0.01	0.00	0.44 (P = 0.32)
Dominant liability
D11S937	−0.19	−0.16	−0.07	−0.02	0.00	0.00	−0.01	0.00 (P = 1.00)
D11S901	−0.69	−0.61	−0.33	−0.11	0.07	0.08	0.03	−0.81 (P = 1.00)
D11S4175	−0.27	−0.25	−0.18	−0.12	−0.06	−0.03	−0.01	0.15 (P = 0.31)
Recessive protective
D11S937	−0.63	−0.55	−0.33	−0.18	−0.05	−0.02	−0.01
D11S901	−2.91	−2.48	−1.49	−0.90	−0.34	−0.11	−0.02
D11S4175	−2.32	−1.65	−0.94	−0.60	−0.27	−0.11	−0.03
Recessive liability
D11S937	−0.99	−0.92	−0.68	−0.47	−0.20	−0.08	−0.02
D11S901	−0.26	−0.25	−0.15	−0.03	0.06	0.06	0.02
D11S4175	0.20	0.23	0.29	0.30	0.23	0.12	0.03

*  Recombination fractions.

†  Nonparametric lod score.

Table 4.

 

Frequency of Polymorphisms in TYR Gene Exons 1 and 4 in Different Populations

Population	n *	Exon 1 575C→A (S192Y)					Exon 4 1205G→A (R402Q)
				C/C	C/A	A/A	G/G	G/A	A/A
Nonpenetrant Families
Total	60	48 (80.0)	12 (20.0)	0	54 (90.0)	6 (10.0)	0
Affected	27	21 (77.8)	6 (22.2)	0	24 (88.9)	3 (11.1)	0
Nonpenetrant	33	27 (81.8)	6 (18.2)	0	30 (90.9)	3 (9.1)	0
Fully penetrant families	50	41 (82.0)	9 (18.0)	0	38 (76.0)	10 (20.0)	2 (4.0)
Saudi control subjects	50	39 (78.0)	10 (20.0)	1 (2.0)	30 (60.0)	19 (38.0)	1 (2.0)
Non-Saudi control subjects	50	18 (36.0)	24 (48.0)	8 (16.0)	30 (60.0)	20 (40.0)	0

*  Individuals tested.

 The values indicate the number of individuals having each genotype (percentage).

Table 5.

 

Independent Sample Frequency of Polymorphism in TYR Exon 4 in Study Subjects with Homozygous and Compound Heterozygous CYP1B1 Mutations

Population	Exon 1 575C→A (S192Y)					Exon 4 1205G→A (R402Q)
		C/C	C/A	A/A	G/G	G/A	A/A
Nonpenetrant	16.0	3.0	0.0	15.5	3.5	0.0
Fully penetrant	15.8	3.2	0.0	17.4	4.9	0.7

 The values indicate the absolute counts as if one sample per pedigree had been randomly collected from each of the 19 nonpenetrant families or the 24 fully penetrant families.

Figure 2.

 

Siblings with identical homozygous CYP1B1 mutations. (A) No evidence of disease; (B) severe bilateral disease. The more severely affected individual showed no differences in skin, hair, or ocular pigmentation.