Clusters of Corneal Epithelial Cells Reside Ectopically in Human Conjunctival Epithelium

Abstract

purpose. The ocular surface is covered by two biologically distinct epithelia: corneal and conjunctival. The expression of keratin12 (K12) is currently considered a hallmark of cornea-type differentiation. In the current study, the biological features of K12-positive cells in human bulbar conjunctival epithelium were examined.

methods. Human conjunctival tissues were subjected to investigate the K12-positive cells in conjunctiva by immunostaining, in situ hybridization, Western blot analysis, reverse transcriptase–polymerase chain reaction (RT-PCR), and fluorescence-activated cell sorting (FACS). Gene expression profiling of these cells was performed with introduced amplified-fragment length polymorphism (iAFLP). To determine the presence of stem- or progenitor cells, immunostaining and colony-forming assays were performed.

results. Western blot analysis, RT-PCR revealed that K12 was expressed in conjunctival epithelium. Immunostaining analysis showed that K12-positive cells reside mainly in clusters in conjunctival epithelium. FACS analysis showed that 0.2% to 1.7% of conjunctival epithelial cells collected from the inferior bulbar conjunctiva were K12 positive. iAFLP analysis revealed that the gene expression patterns of these cells were highly similar to that of corneal epithelial cells. p63 and ABCG2 were expressed beneath the K12-positive cells. Some colony-forming cells expressed K12.

conclusions. The K12-positive cells appear to be ectopically residing, self-maintaining corneal epithelial cells in the conjunctival epithelium.

The ocular surface is covered by two different types of epithelia: the conjunctival and the corneal epithelium. Corneal epithelial cells are continuously supplied from the limbus where their stem cells reside. ^{1 2 3 4 5} Conjunctival epithelial stem cells were found primarily at the conjunctival fornix by colony-forming assay in humans ⁵ and by in vivo label-retaining experiments in rabbits ⁶ and mice. ^{7 8} More recently, time-lapse studies in green fluorescent protein (GFP) mice conjunctiva disclosed the uniform distribution of stem cells in the bulbar conjunctiva. ⁹ In addition, the mucocutaneous junction conjunctiva has been shown to contain stem cells that migrate toward the fornix. ^{10 11} Thus, the site where conjunctival epithelial stem cells reside remains controversial. 

Besides their anatomic segregation, the two types of ocular epithelium possess unique tissue- and cytological properties. For example, conjunctival epithelium does, while corneal epithelium does not, contain mucin-secreting goblet cells. ¹² Our previous gene expression analysis ^{13 14} disclosed that many genes are differentially expressed by these epithelia. Wei et al. ¹⁵ reported that rabbit conjunctival and corneal epithelial cells belong to two separate lineages. Based on these observations, corneal and conjunctival epithelial cells appear to be intrinsically different. 

The current dogma is that the expression of K3/12 is thought to be a hallmark of epithelia with cornea-type differentiation ^{1 15 16 17 18 19 20} and to be indispensable for corneal epithelial homeostasis. ²¹ However, K3 is also expressed in other epithelia, including snout, ¹⁶ gingiva, and tongue ²² and palpebral conjunctiva. ⁶ Also, it has been reported that bovine bulbar conjunctival epithelial cells expressed trace amounts of K3 and were induced to express K3/12 by inoculation onto corneal basement membrane. ²³ Similar findings were made on cultured rabbit conjunctival epithelial cells. ⁶ These reports strongly suggest that the actual expression patterns of K3/12 in ocular surface epithelium are not as clear cut as the current dogma. 

We investigated expression of K12 in human conjunctival epithelium. We found that K12-positive cells are present in this tissue primarily as clusters and appear to possess cellular features highly similar to corneal epithelial cells. Furthermore, they seem to have their own stem- or progenitor cells. Based on our observations, we postulated that the K12-positive cells in conjunctival epithelium are ectopically residing corneal epithelial cells. 

Methods

Human Samples

This study was approved by the Committee for Ethical Issues on Human Research of Kyoto Prefectural University of Medicine and was performed in accordance with the tenets of the Declaration of Helsinki. 

Normal conjunctival tissues were obtained from otherwise healthy eyes at cataract or conjunctivochalasis surgery. The resected normal conjunctivae from the patients with cataract (n = 10; three men and seven women; mean age, 69.0 ± 13.1 years) were 3 × 3 mm² in size and located at inferior bulbar conjunctiva 5 mm distant from the surgical limbus. The resected conjunctivae from the patients with conjunctivochalasis (n = 10; three men and seven women; mean age, 71.6 ± 8.7 years) were 3 to 6 mm (vertical) × 15 mm (horizontal) and located at the inferior bulbar conjunctiva, at least 2 mm distant from the limbus. Prior informed consent was obtained from all subjects after a detailed explanation of the procedures. Cadaveric corneas were obtained from the Northwest Lions’ EyeBank (Seattle, WA). Permission to use the donated corneas for research was obtained from all donor families. 

Cryosectioning

Corneal and conjunctival tissues were embedded in OCT compound (Tissue-Tek; Sakura Finetechnical Co. Ltd., Tokyo, Japan) and snap frozen with liquid nitrogen. Sections were placed on glass slides for immunostaining and in situ hybridization or on slides (Penfoil; Leica Microsystems, Co., Ltd., Wetzlar, Germany) for laser microdissection. 

Immunostaining

Sections or cells were dried and fixed at 4°C with Zamboni’s fixative. Then they were incubated in blocking solution (1% BSA in 0.01 M PBS), incubated in the primary antibodies (Table 1) , washed with 0.01 M PBS, incubated again with the corresponding fluorescence-labeled secondary antibody, immersed in mounting medium, and covered with coverslips. 

Western Blot Analysis

Conjunctival tissue was stretched on a filter paper epithelial side up. With a spatula, the epithelium was mechanically scraped from the tissue with special care taken to avoid breaking the underlying stroma. The collected epithelium was lysed in a buffer containing 25 mM Tris-HCl (pH 7.4), 0.6 M KCl, 1% Triton X-100, and a protease inhibitor cocktail (Complete Mini; Roche Diagnostics, Penzberg, Germany). After centrifugation, pellets were solubilized in sample buffer containing 25 mM Tris-HCl (pH 6.8), 2% SDS, 5% β-mercaptoethanol, 10% glycerol, and 0.005% bromphenol blue (BPB). The samples were electrophoresed, transferred to a polyvinylidene difluoride (PVDF) membrane (HybondP; GE Healthcare, Piscataway, NJ) and immunostained with anti-K12 antibody (1:1000, sc-17098; Santa Cruz Biotechnology, Santa Cruz, CA). 

Fluorescence-Activated Cell Sorting

The conjunctival epithelium was separated from underlying stroma with 1.2 U/mL dispase ²⁴ and further disintegrated with 0.05% trypsin/EDTA. After fixation with 4% paraformaldehyde, the cells were incubated in a blocking buffer containing 0.1 M PBS and 0.5% BSA. After incubation in a permeabilization buffer (0.5% saponin in the blocking buffer), the cells were immunostained with anti-K12 antibody (1;100, sc-17098) or normal goat IgG. After washing in 0.1 M PBS, the cells were stained with Alexa488 anti-goat IgG (Invitrogen, Carlsbad, CA) and analyzed by fluorescence-activated cell sorting (FACS; FACSCaliber, BD Biosciences, San Jose, CA). 

Fluorescence In Situ Hybridization

A specific region for K12 mRNA (nucleotide positions 1337-1792 in NM000223) was amplified and cloned into a T-overhang vector (pGEM-T Easy Vector; Promega, Madison, WI). After confirmation by sequencing, the plasmid was digested with restriction enzyme and used to prepare a sense or antisense digoxigenin (DIG)-labeled RNA probe. 

Frozen conjunctival sections (10 μm) were fixed with 4% paraformaldehyde and incubated in a 0.2-μg/mL proteinase-K solution. Then, they were acetylated with 0.25% acetic anhydride in 0.1 M triethanolamine (TEA; pH 8.0), washed with PBS, and dehydrated with a graded series of ethanol. After 30-minute air drying, they were incubated in hybridization buffer containing 50% formamide, 0.3 M NaCl, 20 mM Tris-HCl (pH 7.5), 5 mM EDTA, 10% dextran sulfate, 1× Denhardt solution (Wako Pure Chemical Industries, Ltd., Osaka, Japan), 500 ng/mL salmon sperm DNA (Invitrogen), 0.5 mg/mL yeast tRNA (Roche Diagnostics), and 10 mM dithiothreitol [DTT] plus 10 ng/mL of the sense or antisense probe. After an 18-hour incubation at 60°C, the sections were washed twice at 52°C for 30 minutes in 0.5× SSC and 50% formamide and then washed twice for 15 minutes at room temperature in 0.2× SSC. After a 30-minute incubation in a blocking buffer, the sections were incubated in horseradish peroxidase (HRP)-labeled anti-DIG antibody (1:100; Roche Diagnostics) solution. After signal intensification by tyramide signal amplification (Biotin-TSA kit; Perkin-Elmer Life Sciences Inc., Boston, MA), the sections were incubated with Alexa488-labeled streptavidin (Invitrogen). 

Reverse Transcriptase–Polymerase Chain Reaction and Real-Time PCR

RNAs were extracted from corneal or conjunctival epithelium, reverse-transcribed, amplified with primer pairs against the genes (Table 2) , and electrophoresed in 2% agarose gels. Southern blot analysis was performed to validate the results. 

Real-time PCR was performed to quantitate the relative gene expression of K12 and ribosomal RNA (for normalization) using a sequence-detection system (Prism 7000 Sequence Detection System; Applied Biosystems, Ltd. [ABI], Tokyo, Japan). (Sequences for these primers and internal probes were not disclosed.) 

Laser Microdissection

For introduced amplified fragment length polymorphism (iAFLP) analysis, K12-positive and K12-negative cells were individually harvested from three individual conjunctivas (Fig. 1)by using a laser-microdissection device (AS LMD; Leica Microsystems). 

Gene Expression Analysis by iAFLP

Corneal or conjunctival epithelial cells were mechanically peeled from five corneas or five conjunctivas. RNAs were extracted from these cells or from six microdissected samples (TRIzol reagent; Invitrogen). 

Comprehensive gene expression profiles were examined with the iAFLP method of Kawamoto et al. ²⁵ slightly modified. Briefly, double-stranded cDNA was synthesized with a pUC119-based vector primer, as described previously, ²⁶ and digested with MboI for subsequent adaptor ligation. Small aliquots (approximately one-sixth) of all digested cDNAs were pooled to obtain a reference sample to connect the data among the different sample sets. Each of the cDNA samples, including the reference sample, was ligated with an individual length polymorphic adaptor (TTnew33-TTnew45 adaptors for individual samples and TTnew48 adaptor for the reference sample). Five different cDNA samples and the reference sample were pooled to make four sample sets in total. After PCR amplification with AntVpPst and T7revBam primers, the four sample sets were digested with BamHI, ligated with the T7-3000 adaptor, and amplified by PCR with a fluorescent-labeled MA20 primer and a gene-specific primer. Gene-specific primers (288 genes) were designed to analyze genes that were dominantly and/or specifically expressed in corneal epithelial cells (for gene selection, we referred to the Bodymap database; http://bodymap.ims.u-tokyo.ac.jp/). Each amplified product was electrophoresed on a fluorescence autosequencer (ABI3100 DNA analyzer; ABI) and the results were analyzed on computer (Genescan and Genotyper software; ABI). The resultant gene expression data were further analyzed with Cluster and Treeview software. ²⁷ All oligomers and adaptors except for gene-specific primers used in iAFLP analysis are listed in Table 2 . 

Virtual Northern Blot

Full-length cDNAs were amplified by a cDNA synthesis kit (Super Smart PCR; BD-Clontech, Mountain View, CA). The cDNAs were electrophoresed, transferred to a nylon membrane, and hybridized with biotin-labeled probes. 

Colony-Forming Assay

A colony-forming assay was performed as described previously. ⁵ Briefly, conjunctival epithelial cells were enzymatically dissociated and seeded on a feeder layer of MMC-treated 3T3 cells. After 4 to 5 days, the cells were fixed with Zamboni’s fixative and subjected to immunostaining. 

Cell Culture

Conjunctival epithelial cells were organotypically cultured on an human amniotic membrane, according to a previously described method. ^{28 29} After 7 days of culture at the air–liquid interface, the cultured conjunctival epithelial sheet was embedded in OCT compound, cryosectioned, and subjected to immunostaining. 

Image Acquisition

All fluorescent images were acquired with a confocal laser (TCS SP2 AOBS; Leica Microsystems) or a fluorescent microscope (Olympus Corp., Tokyo, Japan). All chemiluminescent images were acquired in an intelligent dark box (VersaDoc 5000; Bio-Rad Laboratories, Inc., Hercules, CA). 

Results

K12-Positive Cells in Conjunctival Epithelium

Immunostaining analysis using five donor tissues extending from the peripheral cornea to the bulbar conjunctiva revealed the presence of K12-positive cell clusters in conjunctiva at a site far from the limbus (Fig. 2A) . On average, the farthest K12-positive cell cluster in each sample was located at a distance of approximately 3.7 ± 2.3 mm from the end of Bowman’s membrane. Among these, the farthest was 7.4 mm from the end of Bowman’s membrane, a region that can be considered to be the bulbar conjunctival or the conjunctival fornix. In the limbal area, the expression pattern of K12 was almost the same as that in cornea, except that intermediate to superficial layers tended to retard K12 expression. We examined the existence of such cell clusters in conjunctival epithelia of 10 different subjects. All conjunctivae, except that of one subject (Fig. 2Bj) , exhibited K12-positive cells and clusters in the conjunctival epithelium (Fig. 2B) . Double-immunostaining analysis against K4 and K12 revealed that these keratins were expressed in a mutually exclusive manner (Figs. 2Cd-f) , suggesting that these differentially stained cells have properties different from each other. We further examined the expression of K3 and K13, known to form a heterodimer with K12 and K4, respectively. As expected, the expression patterns for K12 and K3 were very similar (Figs. 2Ca-c) . In contrast, K12 and K13 (Figs. 2Cg-i)presented an image that was similar to the images produced by double-immunostaining against K4 and K12. 

The antibody we used (sc-17098) was raised against the N-terminal partial peptide sequence. To examine the possibility that this antibody reacted with other molecules, immunostaining was again performed with a different K12 antibody. ¹⁷ The hypothetical cross-reactivity was almost completely abolished, as this antibody yielded an expression pattern very similar to that obtained with the other antibody (Fig. 2D) . 

Tissue localization of K12 mRNA, analyzed by in situ hybridization against sections contiguous with immunostained sections, demonstrated a tissue distribution pattern that was highly consistent with that of K12 protein (Fig. 2E) . This finding strongly supported our immunostaining results. Western blot analysis demonstrated that conjunctival epithelial extracts produced a faint but specific band for K12 (Fig. 3A) . RT-PCR analysis revealed that K12 mRNA was expressed in both corneal and conjunctival epithelium (Fig. 3B) . However, real-time PCR analysis disclosed that the expression level of K12 mRNA in conjunctival epithelium was no more than 1% of that in corneal epithelium (Fig. 3B) . FACS analysis also revealed that 0.2% to 1.7% of the conjunctival epithelial cells collected from the inferior bulbar conjunctiva was K12 positive (Fig. 3C) . Taken together, despite individual variations, our findings suggest that as many as 1% of conjunctival epithelial cells seem to be K12 positive. 

As some K12-positive cell clusters were located at quite a distance from the limbus, we hypothesized that these clusters are physiologically independent and spatially segregated from this region. To rule out the possibility that they are simply part of an extended limbal epithelium, we first looked for goblet cells, thought to be present only in conjunctival epithelium, in the vicinity of the K12-positive cell clusters. Double-immunostaining analysis against K12 and Mus5AC clearly demonstrated some MUC5AC-positive goblet cells very close to the K12-positive cell clusters (Fig. 4A) . Next, we carefully inspected the tissue localization of the K12-positive cells in a series of contiguous sections. We found that some K12-positive clusters existed as solitary islands in conjunctival epithelium (Fig. 4B) . 

Similarity of K12-Positive Cells in Conjunctival Epithelium to Corneal Epithelial Cells

As gene expression patterns vary significantly with tissue or cell type, we performed gene expression analysis using iAFLP to assign the K12-positive cells in the conjunctiva to the proper type of ocular surface epithelium. Of the 288 genes we examined, 185 could be analyzed; others could not, possibly due to improper primer sequences. Cluster analysis of the iAFLP data clearly demonstrated that the gene expression profiles of the K12-positive cells in the conjunctiva were similar to those of corneal epithelial cells (Figs. 5A 5B) . Among the genes examined here, 25 genes exhibited apparently different expression patterns (Fig. 5B)between conjunctival and corneal epithelium. Especially, TKT ³⁰ and ALDH3 ³¹ are known as dominant proteins in the cornea. Of note, TGFBI (keratoepithelin), a gene involved in hereditary corneal dystrophies, ³² was highly expressed both in corneal epithelial cells and conjunctival K12-positive cells. These data were further validated by RT-PCR (Fig. 5C)and virtual Northern blot analysis (Fig. 5D) . The results strongly suggest that the K12-positive cells in the conjunctiva possess properties identical or very similar to those of corneal epithelial cells. 

Stem Cells Associated with the K12-Positive Cells in the Conjunctiva

If the K12-positive cells in the conjunctiva are not derived from the limbus, where do these cells come from? We hypothesized that their stem cells reside just beneath them. Therefore, we looked for the expression of stem/progenitor cell markers around K12-positive cell clusters in the conjunctival epithelium. Among several putative markers for limbal basal stem cells, ³³ we examined K12, ³⁴ p63, ^{35 36} and ABCG2. ³⁷ Some basal cells under the K12-positive cell clusters did not express K12 (Fig. 6A) , implying that they were the stem cells of the overlying K12-positive cell cluster. Also, some basal-to-suprabasal cells beneath the K12-positive cell cluster expressed p63 (Fig. 6Aa)and ABCG2 (Fig. 6Ab) , implying that these cells are stem/progenitor cells of the overlying K12-positive cell cluster. To test this hypothesis further, we investigated the colony-forming activity of these cells. As a result, some of the colonies expressed K12 (Fig. 6B) , indicating that such K12 positive colonies are stem/progenitor cells of the K12-positive cells residing in conjunctiva. Then, we tested whether the K12-positive cells in the conjunctiva can be maintained after organotypic culture. We identified K12-positive cells in cultivated conjunctival epithelial sheets (Fig. 7) . 

Discussion

Immunostaining analysis clearly demonstrated the existence of K12-positive cells in human conjunctival epithelium. The results of Western blot analysis, in situ hybridization, FACS, and RT-PCR analyses further supported this observation. Moreover, gene expression analysis by iAFLP strongly suggests that the K12-positive cells in the conjunctiva possess properties highly similar to those of corneal epithelial cells. In addition, the K12-positive cells in the conjunctiva appeared to be maintained by their own stem or progenitor cells. Based on these results, we postulate that these cells are ectopically residing corneal epithelial cells self-maintained in the conjunctiva. 

The most important issue in this study appears to be whether the K12-positive cells in conjunctiva are linked to corneal epithelial stem cells residing in the limbal basal layer. Our data strongly suggest that these cells are self-maintained in conjunctiva and are independent of the limbal basal stem cells. However, the possibility that limbal epithelium extends to such a distant region cannot be completely ruled out. Some radially sectioned corneoscleral tissues (Fig. 2A)demonstrate contiguous K12-positive cells from the limbus, implying this possibility. Investigation of whole ocular surface epithelium from cadaveric donors would shed light on this question. 

Data derived from animal experiments led to the classic concept of conjunctival epithelial transdifferentiation—that is, conjunctival epithelial cells can become corneal epithelial cells under certain conditions, ^{38 39 40 41} thereby making it possible for eyes with total limbal failure to recover completely and exhibit a transparent cornea. Although clinical studies provided evidence in support of the transdifferentiation hypothesis ⁴² in humans, other animal experiments and data based on biochemical studies appeared to render this concept invalid, ^{43 44 45 46 47} because neither regenerating conjunctival epithelium covering the cornea nor organotypically cultured conjunctival epithelium exhibited cornea-specific phenotypes; rather, the phenotype was that of conjunctival epithelium. Based on our results, we postulate that during the epithelial regenerating process in patients with compromised limbal stem cells, ectopically residing corneal epithelial cells in the conjunctival epithelium migrate, cover the denuded cornea, and exhibit bona fide corneal epithelial properties. In this sense, the transdifferentiation concept would be incorrect from a cytological but correct from a clinical perspective. 

In summary, ours is the first study to demonstrate clearly the existence of K12-positive cells in in vivo human conjunctival epithelium. We identified their cellular features by comprehensive gene-expression analysis and found them to be similar to the features of corneal epithelial cells. Moreover, K12-positive cells appear to have their own stem or progenitor cells. We submit the hypothesis that these cells are ectopically residing corneal epithelial cells and that they are self-maintained, even in conjunctival epithelium. Our preliminary findings that K12-positive cells exist in organotypically cultured conjunctival epithelium suggest that these cells can be maintained during the culture process. Sorting of these cells by FACS may allow us to generate cultured corneal epithelial sheets from conjunctiva. Studies are under way in our laboratory to investigate the potential usefulness of conjunctival epithelium to reconstruct the corneal surface in patients with limbal stem cell deficiency. 

 Supported by Grants 15791001 and 16390502 from the Japanese Ministry of Education, Science, Culture and Sports; a grant from the Japanese Ministry of Health, Labor and Welfare; and research funds from the Kyoto Foundation for the Promotion of Medical Science.

 Submitted for publication August 17, 2005; revised November 26, 2005; accepted February 15, 2006.

 Disclosure: S. Kawasaki, None; H. Tanioka, None; K. Yamasaki, None; N. Yokoi, None; A. Komuro, None; S. Kinoshita, None

 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.

 

Table 1.

 

List of Antibodies

Antibody (Clone Name)	Type of Antibody	Immunized Animal	Source	Dilution
CK3(AE5)	Mono	Mouse	PROGEN	×50
CK4(6B10)	Mono	Mouse	Novocastra	×200
CK12(sc-17098)	Poly	Goat	Santa Cruz	×100
CK12	Poly	Rabbit	NC	×100
CK13(KS-1A3)	Mono	Mouse	Novocastra	×200
MUC5AC(CLH2)	Mono	Mouse	Novocastra	×100
ABCG2(BXP-21)	Mono	Mouse	KAMIYA	×40
p63(4A4)	Mono	Mouse	Santa Cruz	×100

 Mono: monoclonal antibody, Poly: polyclonal antibody; PROGEN, PROGEN Biotechnik GmbH, Heidelberg, Germany; Novocastra, Novocastra Laboratories Ltd, Newcastle, UK; Santa Cruz, Santa Cruz Biotechnology Inc., Santa Cruz, CA; NC, not commercially available; KAMIYA, Kamiya Biomedical Company, Seattle, WA.

Table 2.

 

Oligomers

Category	Oligomer	Sequence
RT-PCR	K3_forward	CTGTCAGCATCTCCGTGGT
	K3_reverse	GCACTGAAGCCACCTCCTAA
	K4_forward	AATGTCTGGAGAATGCCAGAG
	K4_reverse	CGTCTCTTGTTCAGGGTGGT
	K12_forward	AAGGTGATGGTTTGGAGGAA
	K12_reverse	AATCATGGGGCAGATCTTGT
	K13_forward	GATCCAGGGACTCATCAGCA
	K13_reverse	AAGGCCTACGGACATCAGAA
	TKT_forward	CTGCTTCATCCGGACCAG
	TKT_reverse	CACACTTCATACCCGCCCTA
	TGFBI_forward	ACCTCAGGAAAGAGGGGATG
	TGFBI_reverse	GGCTGGATTGCTTGATTCAT
	ALDH3_forward	TTGCAGAGACATCCAGTGGT
	ALDH4_reverse	TTGGTCTAGAAAGGGGTGGA
	CTSL2_forward	TTGCTAATGACACTGGCTTCA
	CTSL3_reverse	TGGATCCTCAATGATTCAACTG
	GJA1_forward	GTACCAAACAGCAGCGGAGT
	GJA2_reverse	CAGTTTGGGCAACCTTGAGT
SB	K3_probe	B-AGGTGGCTATGGAGGAGGTT
	K4_probe	B-CAGTGTCTCTGGCAGTTCCA
	K12_probe	B-TGAATGGTGAGGTGGTCTCA
	K13_probe	B-CAGTGAGATGGAGTGCCAGA
	Biotin N20	B-NNNNNNNNNNNNNNNNNNNN
ISH	K12_ISH_forward	GAAGGTGATGGTTTGGAGGAA
	K12_ISH_reverse	TTCCGGGTTACCAGAAGAAA
iAFLP	T7revBam	AGAGGGATATCACTCGGATCCAT
	AntVpPst	GCCAAGCTTGCATGCCTGCATTTTTTT
	TTnew33	AGAGGGATATCACTCGGATCCATCAGTCAGGAT
	TTnew36	AGAGGGATATCACTCGGATCCATATCCAGTCAGGAT
	TTnew39	AGAGGGATATCACTCGGATCCATACTATCCAGTCAGGAT
	TTnew42	AGAGGGATATCACTCGGATCCATTCTACTATCCAGTCAGGAT
	TTnew45	AGAGGGATATCACTCGGATCCATCAATCTACTATCCAGTCAGGAT
	TTnew48	AGAGGGATATCACTCGGATCCATACTCAATCTACTATCCAGTCAGGAT
	NH1400P	P-GATCATCCTGACTG-NH2
	T7_3000	GCACTATAGGGAGATTACTTTAGGACTGAC
	NH14_rev	P-GATCGTCAGTCCTA
	MA20	F-GCACTATAGGGAGATTACTT

 For the 3′ or 5′ modification, B means biotinylation, P means phosphorylation, NH2 means amino-linker, and F means fluorescent dye (6-Fam). Length polymorphic adaptors were made by pooling an equimolar amount of NH1400 oligomer and one of TTnew (TTnew33-TTnew48) oligomers. The T7_3000 adaptor was made by pooling an equimolar amount of T7_3000 and NH14_rev oligomers. All oligonucleotides were synthesized by Promega.

Figure 1.

 

Microdissection of K12-positive and K12-negative cells residing in conjunctival epithelium. Conjunctival K12-positive or -negative cells were selectively collected by laser microdissection (B) by inspecting contiguous K12-immunostained sections (A).

Figure 2.

 

Tissue localization of K12-positive cells in conjunctival epithelium. (A) Expression of K12 in corneoscleral tissues. Corneoscleral tissues were immunostained with anti-K12 antibody (green) and counterstained with propidium iodide (red). Distance from the end of the Bowman’s membrane (open arrowhead) to the most distal K12-positive cell cluster (filled arrowhead) was shown at the right of each sample. (B) Expression of K12 in conjunctival epithelium. Conjunctival tissues were immunostained with anti-K12 antibody (green) and counterstained with propidium iodide (red). Nine samples (Ba–i) exhibit K12-positive cell cluster(s) while 1 sample (Bj) does not. (C) Expression of the four abundant keratins in conjunctival epithelium. Conjunctival tissues were double-immunostained against K3 (Ca) and K12 (Cb), K4 (Cd), and K12 (Ce), or K13 (Cg) and K12 (Ch). Note that K3 and K12 colocalize (Cc), whereas expression of K4 and K12 (Cf) and that of K13 and K12 (Ci) are almost mutually exclusive. (D) K12 expression using two different antibodies. Conjunctival tissue was immunostained against K12 (green) using either goat polyclonal antibody (Da) or rabbit polyclonal antibody (Db). Note that these two different K12 antibodies produced consistent immunostaining results. (E) Expression of K12 mRNA in conjunctival epithelium. The photographs were taken at low (Ea–c) and high (Ed–f) magnification. Images of conjunctival tissues processed by immunostaining (Ea, Ed) or fluorescent in situ hybridization (Eb, Ee; antisense probe, Ec, Ef; sense probe) demonstrate the consistent expression pattern between K12 protein (green) and its mRNA (green).

Figure 3.

 

Expression of K12 in conjunctival epithelium. (A) Expression of K12 protein in conjunctival epithelium (Western blot analysis). NC denotes negative control. Protein samples prepared from the insoluble fraction of conjunctival (lanes 1 to 5, 11) or corneal (lane 6 to 10, 12) epithelial lysates were electrophoresed, transferred, and immunostained against K12 (lanes 1 to 10) or normal goat IgG (lanes 11, 12). Note that the loaded protein amount of corneal samples was reduced to 1:100 of that of conjunctiva to avoid signal quenching. (B) Expression of the keratin genes detected by RT-PCR and real-time PCR. (Ba) The expression of K3, -4, -12, and -13 was analyzed by RT-PCR and validated by Southern blot analysis. Expression of K3 was not detected in conjunctival epithelium with a normal three-temperature thermal setting but was detected under a touchdown thermal condition (*). (Bb) Quantitative expression of K12 in corneal (Cr1, Cr2, Cr3) and conjunctival (Cj1, Cj2, Cj3) epithelia by real-time PCR analysis. The expression level of K12 in conjunctival epithelium was no more than 1% of that in corneal epithelium. (Bc) The kinetics of K12 gene amplification were monitored by real-time PCR. (Open arrowhead) Three corneal samples; (filled arrowhead) Cj2; (filled arrow) Cj3; (open arrow) Cj1. Red horizontal line: the threshold line. (C) FACS analysis of K12-positive cells in conjunctival epithelium. Conjunctival (Ca–d) and corneal (Ce) epithelial cells were dispersed by enzymatic dissociation, fixed, and immunostained against K12. In the conjunctiva, K12-positive cells (purple, M2 region) comprised approximately 0.2% to 1.7% of total analyzed cells. The positive–negative cutoff line was defined according to the signal distribution of the isotype-negative control (red line).

Figure 4.

 

Segregation of conjunctival K12-positive cell clusters from limbal epithelium. (A) Expression of K12 and Muc5AC in conjunctival epithelium. Conjunctival tissue was immunostained against K12 (green) and Muc5AC (red, arrowhead) to demonstrate the spatial proximity of the conjunctival K12-positive cell clusters and goblet cells. (B) Isolated K12-positive cell cluster in conjunctival epithelium. The photographs show a series of contiguous sections to demonstrate that a conjunctival K12-positive cell cluster exists as a solitary island. Note that photographs 2 and 29 represent both edges of the K12-positive cluster.

Figure 5.

 

Gene expression profiling of the K12-positive cells in conjunctiva. Gene expression data on 185 genes from 16 samples were analyzed by hierarchical clustering. The 16 samples comprised corneal epithelial cells from five subjects (Corn-1–Corn-5), conjunctival epithelial cells from five different subjects (Conj-1–Conj-5), and laser microdissected K12-positive (K12(+)1–K12(+)3) and K12-negative (K12(−)1–K12(−)3) cells from three different conjunctivae. Each row represents an individual gene and each column an individual sample. The data were log-transformed (base 2) and centered in row-direction by subtracting the median observed value (log space). The data are depicted according to the color scale (log space) shown at top left. Gray data indicate that the electrophoresis data for the row were under the cutoff. (A) Whole image of two-dimensional hierarchical clustering of 185 genes across 16 samples. The horizontal hierarchical trees show the degree of similarity in the gene expression pattern among the 16 samples. Note that the 16 samples are clearly divided into two groups (red and blue trees). The area demarcated in yellow includes genes with expression that was significantly different in these two groups. (B) Differentially expressed genes between corneal and conjunctival epithelium . The color-coded matrix is a zoomed image of the area demarcated in yellow in (A). At the right, some well-known genes are represented by their symbols: GJA1, gap junction protein; α1 (connexin43); KRT3, keratin3; KRT12, keratin12; TKT, transketolase; CTSL2, cathepsinL2; TGFBI, beta IgH3; ALDH3, aldehyde dehydrogenase 3. Note that microdissected K12-positive samples manifest gene expression patterns highly similar to those of corneal epithelial cells. (C) Validation of the iAFLP results by RT-PCR. Lanes 1, 2: corneal epithelium, lane 3, 4: conjunctival epithelium. All genes, except for the β-actin gene, demonstrate dominant expression in corneal epithelium. All amplicons were confirmed by sequencing analysis. (D) Validation of the iAFLP results by virtual Northern blot. Lane 1, 2: corneal epithelium, lane 3, 4: conjunctival epithelium. Equal amount of amplified cDNAs were electrophoresed and hybridized. Each arrowhead indicates a band of authentic full-length cDNA of each gene.

Figure 6.

 

Presence of stem cells for conjunctival K12-positive cells. (A) Expression of stem cell markers in conjunctival K12-positive cell clusters. Conjunctival tissue was double-immunostained against K12 (red) and p63 (Aa, green) or K12 (red) and ABCG2 (Ab, green) and then counterstained with 4′,6′-diamino-2-phenylindole (DAPI; blue). Note that basal cells beneath the conjunctival K12-positive cell cluster are devoid of K12. (B) Expression of K12 by colony-forming cells of conjunctival epithelium. Conjunctival epithelial cells were dispersed by enzymatic digestion and seeded on MMC-treated 3T3 cells. After colonies became obvious, the cells were immunostained against K12 (green). (Ba) Some colonies expressed K12 (arrow), whereas others did not (arrowhead). (Bb) Zoomed image of the K12-positive colony identified by the arrowhead in (Ba). (Bc) The K12-negative colony identified by the arrow in (Ba).

Figure 7.

 

Expression of K12 in organotypically cultured conjunctival epithelium. Organotypically cultured conjunctival epithelium was immunostained against K12 (green) and then counterstained with 4′,6′-diamino-2-phenylindole (DAPI; blue).

The authors thank Michelle A. Kurpakus for providing the rabbit polyclonal K12 antibody; the staff at the Northwest Lion’s EyeBank Foundation, especially Monty Montoya, Bernie Iliakis, Doug Marcoux, Malcom An, and Jeremy Shuman for helping to obtain fresh human corneal tissues; and Yoshihide Nakai for helping to obtain fresh human conjunctival tissues.