Inhibition of RAP1 Enhances Corneal Recovery Following Alkali Injury

Abstract

Purpose.: Recently, RAP1 (Telomeric Repeat Binding Factor 2, Interacting Protein [TERF2IP]) was discovered as a modulator that selectively regulates nuclear factor light chain kappa enhancer of activated B cells (NFκB) signaling. The roles of RAP1 in regulation of inflammation and angiogenesis for corneal recovery following corneal injury remain poorly understood. The effects of RAP1 deletion on corneal resurfacing and neovascularization in a corneal alkali burn mouse model were examined.

Methods.: Corneal defects and neovascularization were induced in vivo by infliction of an alkali burn to the cornea with 1 N sodium hydroxide solution in RAP1 knock-out (RKO) and wild-type (RWT) mice. Corneal resurfacing was evaluated using slit-lamp biomicroscopy. Neovascularization following injury was evaluated by bright view biomicroscopy and immunofluorescence staining with the endothelial marker platelet endothelial cell adhesion molecule (PECAM). The cytokine profiles of corneal tissue involved in inflammation and neovascularization following injury was compared between RKO and RWT mice. Corneal epithelial cells were isolated for classic scratch wound healing assay and further testing with lipopolysaccharide stimulation.

Results.: Resurfacing of the burned cornea was accelerated and angiogenesis was suppressed, faster recovery of corneal epithelial cells from classic scratch wound healing and superior tolerance of lipopolysaccharides challenge was observed in the RKO compared to RWT. Molecular investigation revealed that deletion of RAP1 reduced upregulation of inflammatory cytokine (IL1A), finely regulated the expression of angiogenic factor (VEGF), and antiangiogenic factor (PEDF), following injury for better corneal recovery.

Conclusions.: Deficiency of RAP1 facilitates corneal recovery after injury. Specificity of RAP1 inhibition may lead to design of specific inhibitors of NFκB in the treatment of ocular injuries.

Introduction

The failure of appropriate corneal repair following severe injury (such as chemical burn injuries) often leads to loss of vision. Alkali burn is one of the most severe corneal injuries because alkali agents are lipophilic. Such chemicals penetrate tissue more rapidly than acids to reach the corneal stroma and destroy tissues with a consequent severe inflammatory response.^1,2 Nuclear factor kappa light chain enhancer of activated B cells (NFκB) signaling family factors have been implicated in the regulation of inflammation³ and angiogenesis^4–6 in many cell types, including corneal epithelial cells.^7–10 Given the multifaceted effects of NFκB activity on cardiac, bone and cancer cell fates,¹¹ different molecular cascades that regulate NFκB activity may result in diverse biological outcomes of NFκB signaling in different cell types and at different time points. Prolonged activation of NFκB has a key role in aberrant inflammatory cytokine expression and neovascularization, and the pathogenesis of corneal wound healing.^12,13 Inhibition of NFκB pathways may protect against inflammation-induced apoptosis and reduce corneal angiogenesis after corneal alkali injury.^14,15 Nevertheless, the NFκB pathway is vital in maintaining normal host defense and generating innate immune responses to pathogens and microbial products, so complete blockade of NFκB would likely produce unwanted side effects. An ideal NFκB inhibitor for drug and therapeutic development would ablate the proinflammatory actions, but preserve the autoregulatory, anti-inflammatory, and other restorative mechanisms to readjust these multiple interrelated processes.¹⁰ The use of transgenic animals is a helpful tool to elucidate the role and mechanisms of specific factor modulating NFκB activation in corneal recovery following severe alkali burn. 

Recently, we performed a genome-wide gain-of-function screen and unexpectedly identified a telomeric protein RAP1 (Telomeric Repeat Binding Factor 2, Interacting Protein [TERF2IP]) as an inhibitor kinase (IKK) adaptor that modulates NFκB in a dose-dependent manner.^16–18 The RAP1-mutant mice are resistant to endotoxic shock and show defective NFκB signaling in response to lipopolysaccharide (LPS) stimulation. This results in reduced upregulation of inflammatory cytokines, such as TNF-α and IL-1.¹⁶ Corneal repair following alkali injury is closely linked to activation of NFκB-mediated inflammatory cytokines^14,15 and angiogenic cytokines.^19,20 We, therefore, set out to determine whether modulation of NFκB signaling by inhibition of RAP1 could promote corneal recovery following injury by regulating inflammatory cytokines and angiogenic factors. 

In this study, we compared RAP1 wild-type (RWT) and RAP1 knock-out (RKO) mice to investigate the effects on corneal wound healing following alkali injury, and expression levels of inflammatory cytokines/angiogenic factors after injury. Compared to wild type mice, RAP1-deficient mice displayed better corneal recovery following alkali injury that was accompanied by reduced upregulation of inflammatory factor (IL1A), and fine regulated levels of angiogenic factor (VEGF) as well as that of antiangiogenic factor (PEDF). 

Materials and Methods

Induction of Central Corneal Alkali Injury in RWT and RKO Mice

All animal experiments were performed in accordance with relevant guidelines and regulations by the University of Hong Kong, and approved by the Committee on the Use of Live Animals in Teaching and Research (CULTAR). We declare our animal protocol is in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. More details on mouse line¹⁶ and genotyping are described in the Supplementary Material. 

To compare the effects of RAP1 gene deletion on the healing of the cornea following alkali injury, a similar alkali burn was administered to the corneas of RWT and RKO mice. We assessed wound healing by corneal resurfacing and angiogenic response. 

Under general anesthesia, an ocular surface alkali burn was inflicted to both eyes of adult RWT (N = 64) and RKO (N = 64) mice by application of 3 μL 1 N sodium hydroxide solution to a confined circular area of approximately 2-mm diameter in the central corneal region.¹⁴ 

Examination of Corneal Resurfacing and Angiogenic Response Following Alkali Injury

For corneal resurfacing, bright view slit-lamp microphotography examination and fluorescein microphotography examination of the corneal surface were performed after injury with fluorescein stain. This was monitored with the slit-lamp system. Eyes also were collected (at baseline, and 6 hours, and 1 and 14 days after injury; N = 32) for total mRNA extraction and subsequent real-time PCR studies of inflammatory cytokines. 

For angiogenesis response, bright view microphotography examination was done. Angiogenic response was monitored at various postinjury time points (days 0, 7, and 14; N = 8) with a light microscope (Nikon SM2800; Nikon, Tokyo, Japan) and photographed (Catalog No. Infinity 1-3C; Chinetek Scientific, Hong Kong, China). Corneas were dissected from the eye at each postinjury time point (days 3, 7, and 14; N = 24) and flat-mounted for platelet endothelial cell adhesion molecule (PECAM, Catalog No. sc18916; Santa Cruz Biotechnology, Santa Cruz, CA, USA) fluorescence staining. Eyes also were collected for total mRNA extraction and subsequent real-time PCR study of angiogenic cytokines. The Table shows the accession numbers and primers for mouse cytokines expression by real-time RT-PCR analysis. The PECAM immunofluorescence staining and imaging were performed for whole cornea and magnified parts of a particular cornea were monitored. More details are described in the Supplementary Material. 

Wound Healing Scratch Assay and LPS Challenge in RWT and RKO Corneal Epithelial Monolayer Cultures

Briefly, when cell culture reached confluence, a classic wound healing scratch assay (also called migration assay) was performed and different time points of wound recovery were recorded in addition to observed LPS challenge for wound healing. More details are described in the Supplementary Material. 

Statistical Analysis

A P value of <0.05 was considered statistically significant. More details are described in the Supplementary Material. 

Results

Deletion of RAP1 Promotes Corneal Resurfacing Following Alkali Injury

To investigate the effects on corneal resurfacing, a mouse model of central corneal surface burn was induced in RWT and RKO mice. Their genotypes were confirmed (Supplementary Fig. S1) as described previously.¹⁶ Slit-lamp biomicroscopy was performed at various time points before and after injury (days 0, 3, 7, and 14) for bright field images and fluorescein images (Figs. 1A, 1B). 

Figure 1

 

The effects of deletion of RAP1 on edema and corneal resurfacing post alkali burn. (A) Slit-lamp biomicroscopy was performed at various time points before and after injury (days 0, 3, 7, and 14) for bright field images (upper) and fluorescein images (lower) for RWT and RKO groups. Corneal defects as visualized by staining with fluorescein, cornea defects in green shows the extent of the ocular surface injury in the RWT and RKO groups. Representative photographs of corneal defects in a central corneal injury model for RWT and RKO were shown. Bright field images of (i–v) RWT and (x–xiv) RKO at various time points. The severity of corneal defeat in RKO group was less than that in RWT group. (edema, arrow; *opacity; RWT, N = 4; RKO, N = 4). Scale bars: 2 mm. Green fluorescein staining for corneal defeat in (vi–ix) RWT and (xv–xviii) RKO groups at various time points. These fluorescein images are corresponding to the bright images. Corneal defeat recovery was significantly faster in the RKO group than RWT group. (B) The percentages of corneal defeat retained post alkali burn were calculated by the area defeat of a particular time point divided by the area of corneal defeat on postinjury day 0 (immediately after the burn was induced). The higher the percentage of defect retained in the particular time point, the slower the corneal resurfacing it means. No defects retained early on day 7 in RKO group, while RWT mice had an average of 67.69% ± 3.39% on day 7 (RWT, N = 4; RKO, N = 4).

A slit-beam illumination was used to investigate the degree of edema and corneal opacity. Bright field images were captured. The results showed that corneal recovery was faster in RKO than RWT mice. Edema (Fig. 1A, arrow; upper panel of RWT) was very obvious on days 3 and 7 in RWT mice. No edema, but corneal opacity (Fig. 1A, asterisk; upper panel of RWT) was observed on day 14. In contrast, little edema (Fig. 1A, arrow; upper panel of RKO) was observed on days 3 and 7 in RKO mice. The corneas in these mice became transparent on day 14 (Fig. 1A, upper panel of RKO). 

Green fluorescein staining was used to evaluate corneal surface healing as determined by area of corneal defect¹⁴ which stained green. Corneal defeat is taken as 100% on postinjury day 0 (Fig. 1). The RWT and RKO mice were monitored for 14 days (Figs. 1A, 1B). Corneal defect recovery was significantly faster in the RKO group than the RWT group. In the RWT group, the corneal surface stained positive on days 3 and 7; negative fluorescein staining was observed on day 14 (Fig. 1A, lower panel in RWT). In contrast, the corneas of the RKO group were less positive to fluorescein staining on day 3, and negative on days 7 and 14 (Fig. 1A, lower panel in RKO). The percentages of epithelial defect retained in RKO mice were significantly reduced compared to RWT mice (Fig. 1B). The retained percentages for RWT and RKO were 100% and 100% on day 0, 88.60% ± 4.13% and 50.96% ± 6.23% on day 3 (*P < 0.01), 67.69% ± 3.39% and 0% on day 7 (*P < 0.01), and 0% and 0% on day 14 (Fig. 1B). 

Deletion of RAP1 Enhances Cell Migration of Corneal Epithelial Cells

Cells cultured from RWT and RKO mice stained positive in response to the corneal epithelial marker K3, but negative to the conjunctival epithelial cell marker K19 (Supplementary Fig. S2). This confirmed their identities as corneal epithelial cells. 

An in vitro scratch wound healing assay was used to assess the role of RAP1 deletion in migration.^3,21,22 Confluent dishes of corneal epithelial cells isolated from corneas of RWT and RKO mice were wounded by scraping with a 10-μL pipette tip (Tip One; USA Scientific, Inc., Ocala, FL, USA), creating a space free of cells (Figs. 2A, 2B). The rate of wound closure was faster in RKO mice than RWT mice, evident 24 hours after scraping. The percentages retained for RWT and RKO were: 100% and 100% at 0 hours, 86.47% ± 19.13% and 56.71% ± 4.43% at 6 hours, 65.63% ± 9.32% and 43.52% ± 0.76% at 12 hours, and 25.48% ± 6.37% and 5.06 ± 0.93% at 24 hours. Deletion of RAP1 facilitates migration of corneal epithelial cells upon wound scraping. 

Figure 2

 

Effects of deletion of RAP1 on healing of scratched wounds. (A) The RWT and RKO corneal epithelial cells cultured in 12-well plates were injured with a sterile 10-μL pipette tip at 0 hour. The wounded culture was allowed to re-epithelialize. The percentages of area change of a particular time point in reference to the area of the initial time point (0 hour; immediately after scratch) was monitored over 24 hours at 37°C. Representative culture of the RWT at times 0, 6, 12, and 24 hours was displayed on the left, while the RKO culture at the same time points was displayed on the right. The RKO group exhibited significantly faster wound recovery. Compared to RWT, more rapid wound healing was observed in RKO mice at 24 hours to a nearly full recovery (RWT, N = 2; RKO, N = 2) Scale bars: 200 μm. (B) Effect of deletion of RAP1 on cell migration in (A) is presented in a graph. The percentages of cells retained in the wound region are presented; the percentage of retained wound (RWT or RKO) was defined as the area of wound retained at the particular time point (6, 12, or 24 hours) divided by the area of the original wound at 0 hour in the microscopic view. RAP1 wild-type cell culture had 25.48% ± 6.37% wound retained, while RKO cell culture had 5.06% ± 0.93% wound retained on 24 hours (RWT, N = 2; RKO, N = 2).

Absence of RAP1 Reduced LPS-Inhibited Wound Healing

Lipopolysaccharides (LPS) provide a potent inflammatory stimulus and their presence has major effects on the determinants of inflammation and apoptosis.²³ To evaluate the effects of RAP1 deletion on response to LPS insult, corneal epithelial cell cultures were challenged with (100 ng/mL) LPS^24,25 for 24 hours following wound scratching.^24,25 

The results revealed that RKO mice were more tolerant than RWT to LPS stimulation and demonstrated a faster wound healing response evident 24 hours after scraping (Fig. 3A). The percentages retained for RWT and RKO were 100% and 100% at 0 hours, 81.77% ± 13.91% and 87.33% ± 4.70% after 6 hours, 69.81% ± 3.05% and 66.58% ± 3.71% after 12 hours, and 66.63% ± 4.73% and 0% (*P < 0.01) after 24 hours (Fig. 3B). Cells in the RKO group had a superior recovery response to LPS stimulation than RWT. 

Figure 3

 

Effects of deletion of RAP1 on wound healing upon LPS stimulation. (A) The RWT and RKO corneal epithelial cells cultured in 12-well plates were injured with sterile 10-μL pipette tips at 0 hours, and cultured with (100 ng/mL) LPS supplement cultured medium. The wounded culture was allowed to re-epithelialize for 2 4hours at 37°C. The percentages of area change of a particular time point in reference to the area of the initial time point (0 hour; immediately after scratch) was monitored over 24 hours at 37°C. Representative culture of the RWT at time 0, 6, 12, and 24 hours was displayed on the left, while the representative RKO culture at the same time points was displayed on the right. Compared to RWT, more rapid wound healing was observed in RKO mice at 24 hours to a full recovery (RWT, N = 2; RKO, N = 2) Scale bars: 200 μm. (B) Effect of deletion of RAP1 on LPS-challenge in (A) was presented in a graph. The percentages of cells retained in wound regions are represented for the time points. The percentage of retained wound (RWT or RKO) was defined as the area of wound retained at the particular time point (6, 12, or 24 hours) divided by the area of the original wound at 0 hours in the microscopic view. The RWT group had an average of 66.63% ± 4.73% wound retained on 24 hours (RWT, N = 2; RKO, N = 2; *P < 0.01).

Absence of RAP1 Reduced Inflammatory Cytokine IL1A After Alkali Injury

The IL1A is known to be a master gene that upregulates inflammation and various cellular responses in corneal recovery.²⁶ Expression of IL1A is upregulated and peaks at 6/24 hours after alkali injury,^27,28 in part via the NFkB/RAP1 signaling pathway. We compared the IL1A expression dynamics in alkali-burned corneas in RWT to RKO mice, at each of the time points by real-time RT-PCR; the relative level of expression for RKO was presented as the ratio of RKO against RWT. The relative expression of RKO compared to RWT at the pre-injury time point was taken as the baseline (Fig. 4). Expression of IL1A was markedly less upregulated in the RKO group compared to the RWT group (Fig. 4, *P < 0.01). In RKO mice, IL1A expression was 8.33-fold lower after 6 hours compared to RWT mice following corneal alkali injury (*P < 0.01) and 4-fold lower after 24 hours (*P < 0.01). On recovery day 14 (1.23-fold), in RKO, IL1A level returned to baseline level compared to RWT (1.34-fold, Fig. 4). Collectively, RAP1 deletion could finely regulate the expression of the inflammatory cytokine, IL1A at 6 and 24 hours after injury. 

Figure 4

 

The effect of deletion of RAP1 on the relative mRNA expression level of IL1A of RKO compared to RWT in the corneas post alkali burn. The relative expression of IL1A in corneas was measured at various time points for RKO compared to RWT. The relative expression level at a particular time point is calculated as a ratio of expression level of the RKO group over which of the RWT group. The relative expression of RKO to RWT at time point pre-injury was taken as the baseline level. Compared to RWT corneas, the relative expression level of IL1A was significantly less upregulated in RKO group at 6 hours (~8.33-fold, *P < 0.01), day 1 (~4.07-fold, *P < 0.01), and returns to baseline on day 14 (~1.23-fold) after alkali injury. (RWT, N = 16; RKO, N = 16).

Reduced Angiogenic Response to Alkali Injury in Corneas of RKO Mice

Alkaline was administered to the corneas of RWT and RKO mice to examine the effects of deletion of RAP1 (RKO) on corneal neovascularization. Bright view microscopy was performed over 14 days (after injury days 0, 7, and 14). The total area of thick and thin blood vessels was observed and measured for four corneas from either RWT or RKO mice on days 0, 7, and 14 after injury (Fig. 5A). 

Figure 5

 

The effects of deletion of RAP1 on angiogenesis response after alkali injury. (A) Representative photographs of corneal neovascularization in a central corneal injury model. Dorsal and lateral images were presented for RWT and RKO corneas on days 0, 7, and 14 after injury time points. The RWT and RKO images are illustrated on the left and the right columns, respectively. The severity of corneal neovascularization in the RKO group was less than that in the RWT group (neovascularization was marked by arrows; RWT, N = 4; RKO, N = 4). Scale bars: 2 mm. (B) The mean total areas of new vessels were graphically presented. The total areas of new vessels from each cornea from the RWT and RKO groups were separately quantified by ImageJ (http://imagej.nih.gov/ij/; provided in the public domain by the National Institutes of Health, Bethesda, MD, USA) for various time points (days 7 and14). A significant decrease of angiogenesis response was observed in RKO group on day 7 (RWT and RKO; 1.27 ± 0.22 and 0.40 ± 0.09 mm²; *P < 0.01) and day 14 (RWT and RKO; 1.49 ± 0.24 and 0.13 ± 0.024 mm²; **P < 0.001) compared to RWT group (RWT, N = 4; RKO, N = 4).

A weaker corneal angiogenic response was observed in the RKO group compared to RWT. Corneal angiogenesis gradually increased from days 7 to 14 in the RWT group, but reduced in the RKO group at the same time points (Fig. 5A). The mean areas of corneal neovascularization of RWT and RKO were: 1.27 ± 0.22 and 0.40 ± 0.09 mm² on day 7 (*P < 0.01), and 1.49 ± 0.24 and 0.13 ± 0.024 mm² on day 14 (**P < 0.001, Fig. 5B). Thus, corneal neovascularization was significantly reduced by deletion of RAP1 (Fig. 5B). 

Reduced Endothelial Vessels (PECAM-Positive) Sprouting From the Limbus to the Center of the Cornea in RKO Mice

To confirm the angiogenic response in RWT and RKO mice corneas, corneas were stained with an endothelial cell marker, PECAM, to identify new vessels sprouting from the limbus region. These images have been merged to reconstruct a full view of a particular cornea (Figs. 6A, 6B). The total areas of PECAM-positive corneal vessels were measured from 4 corneas each of RWT and RKO mice and at each time point. Fewer PECAM-positive vessels were observed in RKO mice on day 7 (Fig. 6A) and day 14 (Fig. 6B) compared to RWT. In contrast, more PECAM-positive stained blood vessels were observed in the corneas of RWT mice at the same time points (Figs. 6A, 6B). The mean areas for RWT and RKO mice were 3.61 ± 0.18 and 1.55 ± 0.29 mm² on day 7 (*P < 0.01, and 8.42 ± 0.86 and 0.10 ± 0.01 mm² on day 14 (*P < 0.01, Fig. 6C). Neovascularization in RKO mice was significantly reduced compared to RWT at various time points following alkali injury. 

Figure 6

 

(A–E) Deletion of RAP1 inhibits angiogenesis in the mouse cornea after alkali injury. (A) Alkali injury was administered on the central corneal region for RWT and RKO group mice in vivo. Corneas were dissected and collected on the various time points (days 7 and 14) for whole mount and stained with endothelial marker, PECAM. Representative PECAM-positive images of whole mount corneas of RWT (left) and RKO (right) on day 7 after injury (RWT, N = 4; RKO, N = 4). Scale bars: 1 mm. (B) Representative PECAM-positive images of whole mount corneas of RWT (left) and RKO (right) on day 14. Neovascularization was inhibited in PECAM-stained corneas from RKO on (A) day 7 and (B) day 14, compared to RWT corneas of the same time point (RWT, N = 4; RKO, N = 4). Scale bars: 1 mm. (C) Quantification of mean total areas of blood vessel sprouting in RWT and RKO mice. Total area of the PECAM-positive vessels very quantified for individual RWT and RKO cornea. Mean areas for RWT and RKO groups were shown in the graph. The sprouting of blood vessels was significantly reduced in RKO mice compared to RWT mice, less blood vessel sprouting in RKO at day 7 (RWT and RKO; 3.61 ± 0.18 and 1.55 ± 0.29 mm², *P < 0.01) and day 14 (RWT and RKO and 8.42 ± 0.86 and 0.10 ± 0.01 mm²; *P < 0.01; RWT, N = 8; RKO, N = 8). (D) Magnified images of PECAM-positive vessels from the corneas (actual size 2.4 mm² surrounding the limbus region). Representative photographs were extracted from sections marked with asterisks from Figures 6A and 6B on the various time points (days 3, 7, and 14); RWT (left column) and RKO (right column). Neovascularization was inhibited in PECAM-stained corneas from RKO on days 3, 7, and 14 (RWT, N = 12; RKO, N = 12; Scale bars: 1 mm) when compared to RWT. (E) Quantification of blood vessel sprouting in RWT and RKO mice on magnified (*) images from Figures 6A and 6B. The sprouting of blood vessels was significantly reduced in RKO mice compared to RWT mice, less blood vessel was sprouting in RKO in day 3 (RWT and RKO; 0.27 ± 0.02 and 0.08 ± 0.01 mm² ; **P < 0.001), blood vessel sprouting in RKO in day 7 (RWT and RKO; 0.63 ± 0.06 and 0.31 ± 0.05 mm²; *P ≤ 0.01), and day 14 (RWT and RKO; 1.92 ± 0.05 and 0.02 ± 0.003 mm²; **P < 0.001; RWT, N = 12; RKO, N = 12).

Magnified images (Fig. 6D, ~2.4 mm² of the actual size from the cornea around the limbus) of corneas were captured from RWT and RKO mice. Representative images are presented, extracted from their corresponding images, in Figures 6A and 6B (asterisks). Progression of PECAM-positive stained blood vessels was observed in the corneas of RWT mice on days 3, 7, and 14 (Figs. 6D, 6E). Fewer PECAM-positive vessels were observed in RKO than RWT: PECAM-positive vessels were significantly reduced on day 14 (Figs. 6D, 6E). The mean areas of the PECAM-positive stain in the magnified images are shown in Figure 6E. The areas in RWT and RKO mice were 0.27 ± 0.03 and 0.076 ± 0.01 mm² on day 3 (**P < 0.001), 0.63 ± 0.1 and 0.31 ± 0.08 mm² on day 7 (*P ≤ 0.01, and 1.92 ± 0.09 and 0.018 ± 0.01 mm² on day 14, respectively (**P < 0.001, Fig. 6E). Collectively, these data demonstrated that deficiency in RAP1 can reduce the angiogenic response to corneal alkali injury. 

Fine Regulation of Angiogenic and Anti-Angiogenic Factors in RKO Mice Corneas Following Alkali Injury

To evaluate the effects of RKO on angiogenesis responses in alkali-burned corneas, we performed real time RT-PCR on the angiogenic cytokines, VEGF, and PEDF (Fig. 7). Expression of RKO was compared to RWT at each time point; the relative level of expression for RKO was presented as the ratio of RKO against RWT. The relative expression of RKO compared to RWT on the pre-injury time point was taken as the baseline (Figs. 7A, 7B). 

Figure 7

 

The effects of deletion of RAP1 on the relative mRNA expression of (A) PEDF and (B) VEGF in RKO corneas compared to RWT corneas after alkali injury. The relative expression of (A) PEDF and (B) VEGF in corneas was measured at various time points (pre-injury, post injury 6 hours, and days 3, 7, and 14) for RKO compared to RWT. The relative expression at a particular time point is calculated as a ratio of expression of RKO over that of RWT at a particular time point. The relative expression of RKO to RWT on preinjury time point was taken as the baseline level. Compared to RWT, at 6 hours after injury in the RKO group, the relative expression level of PEDF (~2.63-fold, *P < 0.01) was significantly reduced, while that of VEGF was significantly upregulated (~2.15-fold, *P < 0.01). On day 7 post injury in RKO mice, dynamic changes to the relative expression levels of VEGF (~ 1.79-fold downregulated, *P < 0.01) and PEDF (~2.20-fold upregulated, *P < 0.01) were observed. (RWT, N = 20; RKO, N = 20).

Compared to corneas of RWT mice, real time RT-PCR showed marked relatively downregulation (2.63-fold, *P < 0.01) of PEDF mRNA expression in RKO corneas 6 hours after injury, but relatively upregulation (2.15-fold, *P < 0.01) of VEGF in RKO. In addition, when PEDF expression was relative upregulated 2.20-fold (*P < 0.01) in RKO corneas on day 7, VEGF levels were relative downregulated 1.79-fold (*P < 0.01). Level of cytokine expression (PEDF and VEGF) returned toward normal (baseline) upon recovery on day 14 (1.41- and 0.97-fold respectively) in RWT and RKO groups (Figs. 7A, 7B). These data demonstrates that deletion of RAP1 finely controls the expression levels of angiogenic and antiangiogenic factors for better corneal injury and recovery process compared to RWT. 

Discussion

Alkali seriously damages the cornea and causes loss of vision in humans, and provokes inflammatory and angiogenic responses that result in a release of inflammatory cytokines and angiogenic factors, activation of NFκb pathway,¹⁴ and a cellular cascade including cell proliferation, and cell apoptosis in the corresponding corneal²⁶ and endothelial cells.^20,29 Prolonged activation of NFκB has a key role in aberrant inflammatory cytokine expression and neovascularization,^12,13 and often results in pathogenic corneal wound healing with consequent vision loss.³⁰ 

In alkali injury, inhibition of NFκB that can reduce corneal angiogenesis may serve as a therapeutic strategy.¹⁵ The NFκB inhibitors have shown anti-inflammatory effects and include emodin, besifloxacin, BOL-303242-X (mapracorat), thymosin-β4, epigallocatechin gallate, Perilla frutescens leaf extract, and IKKβ-targeting short interfering RNA.^10,31 Nevertheless inhibition of NFκB has shown variable results and its multifaceted and cell type specificity^6,15,32–37 is associated with the fine control of healing of epithelial cells.³⁸ A therapeutic strategy of fine modulation of NFκB signaling rather than complete blockage of NFκB, therefore, is important to preserve the autoregulatory, anti-inflammatory, and other restorative mechanisms and readjust these multiple interrelated processes.^39,40 

Most common NFκkB dimer is composed of p50 and p65 subunit and this is activated in many cancers. The SN50 peptide blocks this dimer and, hence, NFκkB activation response. This is a very generic mechanism of blocking NFκKB, much like inhibiting the upstream kinases, which, though effective in in vitro settings, can lead to many toxic effects in vivo.⁴¹ The Rap1 was identified as a telomeric protein and its role in inflammation is considered its noncanonical function. The Rap1 activated NFκkB by making it a strong chromatin remodeler. The NFκkB p65 subunit is modified by phosphorylation induced by IKKs, which are kinases that also mark IkB proteins for degradation. Only p65 that is modified by IKK in presence of Rap1 is capable of binding p300/CBP and open chromatin on specific promoters. Hence, inhibiting Rap1 is much more specific than generally inhibiting NFκkB by SN50, which will block NFκkB binding to all sites. Such specificity of Rap1 inhibition will lead to design of much more specific inhibitors of NFκkB and inflammation. This is apparent in many in vivo assays presented here and in the fact that Rap1 null mice are normal until challenged by stress-inducing agents. Like Rap1, the role of telomerase⁴² in regulating inflammation is now well appreciated and targeting telomerase is considered a worthwhile therapy.⁴³ 

In this study we have shown that RAP1 is an effective modulator of NFκB signaling that, in turn, is required for cytokine regulation and subsequent fine healing of corneal injury. Our results demonstrated that inhibition of NFκB by inhibition of RAP1 facilitates corneal healing. Corneal resurfacing was associated with reduced upregulation of inflammatory cytokines, while in corneal angiogenesis, repressed induction of angiogenesis was associated with reduced upregulation of angiogenic factors, but increased upregulation of antiangiogenic factors. Inhibition of RAP1 facilitates cell migration in vitro and increases tolerance to bacterial challenge. Our findings are consistent with those described previously that inhibition of NFκB signaling facilitates corneal recovery, corneal resurfacing,¹⁵ reduced angiogenesis,¹⁴ and stress resistance,¹⁶ and is associated with fine regulation of inflammatory cytokines, angiogenic factors, and antiangiogenic factors. 

The IL1A is a prime proinflammatory cytokine arising from NFκB activation⁴⁴ and the first to be released following injury for repair, proliferation, apoptosis, motility, differentiation, and necrosis in various cell types, including epithelial cells.^26,45 Timely and tightly controlled angiogenic VEGF and antiangiogenic PEDF factors have important roles in corneal repairs following injuries^46,47 that are associated with NFκB signaling regulation.^20,29 

This study provides in vivo evidence that a reduced RAP1 level promotes corneal repair following alkali-induced damage, and is associated with a reduced upregulation of inflammatory and angiogenic cytokines. Inhibition of RAP1 enhances corneal recovery and may serve as a novel therapeutic target that can fine regulate NFκB signaling-mediated inflammatory and angiogenic responses.1552 

Table

 

Primers for Mouse Cytokines by Real-Time RT-PCR Analysis

Transcripts	Accession Numbers	Forward Primers 5′–>3′	Reverse Primers 5′–>3′
Inflammatory cytokine
mIL1A	NM010554.4	GACAGTATCAGCAACGTCAA	TCACTCTGGTAGGTGTAAGG
Angiogenesis cytokines
mVEGF	NM_001025250.3,NM_009505.4, NM_001025257.3	CCCGACGAGATAGAGTACAT	CTGGCTTTGGTGAGGTTT
mPEDF	NM011340.3	CCCGACTTCAGCAAGATTAC	CCCTCAGAACAAAGAGGAAAG
Housekeeping
mGAPDH	NM008084.2	CCACTCACGGCAAATTCA	AGTAGACTCCACGACATACTC

 The Table shows the accession numbers, oligonucleotide sequences of forward and reverse primers of selected candidates of inflammatory (IL1A), and angiogenesis cytokines (VEGF and PEDF) together with the house keeping probe (GAPDH). m, mouse.

Acknowledgments

Supported in part by grants from the RGC Research Grant (N_HKU 716/09, HKU3/CRF/11R, and T12-705/11 to [QL]); National Natural Science Foundation of China (31270967 [QL]); small project funding from The University of Hong Kong (201111159183 and 201211159030 [QL], and 201109176184 and 201309176129 [MWP]); and a core grant to IMCB from A*star (VT). 

Disclosure: M.W. Poon, None; L. Yan, None; D. Jiang, None; P. Qin, None; H.-F. Tse, None; I.Y. Wong, None; D.S.H. Wong, None; V. Tergaonkar, None; Q. Lian, None