Abstract
Purpose: :
αA crystallin treatment ameliorates EAU by suppressing innate and adaptive immunity and photoreceptor apoptosis from mitochondrial oxidative stress. MicroRNAs; the small non-coding RNAs that regulate gene expression may regulate immune responses and apoptosis.We investigated (a) Modulation of microRNAs by αA crystallin during EAU (b) microRNA therapeutic intervention in EAU.
Methods: :
Two groups of B10RIII mice were immunized with IRBP peptide. One group was treated with αA crystallin recombinant protein (10µg) on alternate days from day 12 post immunization (p.i) by intravenous injection till day 21 and the other group injected with a non-relevant protein. Retinas were extracted on day 21 and subjected to whole mouse genome microRNA PCR array (SaBiosciences). Similarly,three more groups of B10RIII mice were induced with EAU and treated with miRIDIAN microRNA mimics for mmu-miR-146a (UGAGAAC UGAAUUCCAUGGGUU) and mmu-miR-155 (UUAAUGCUAAUUGUGAUAGGGGU) intravenously. The control group consisted of mice injected with miRIDIAN microRNA negative controls. Eyes were enucleated and subjected to immunohistological analysis and IRBP localization.
Results: :
The microRNA pcr array showed downregulation of 30 microRNAs in EAU mice compared to controls. However, in mice treated with αA crystallin, most of these downregulated microRNAs were upregulated. The most significantly upregulated microRNAs were mmu-miR-146a and mmu-miR-155. Immunohistological analysis of the eyes of animals treated with microRNA mimics 146a and 155 showed marked reduction in intraocular inflammation with prevention of photoreceptor loss. Whereas, the eyes treated with control miRNA showed photoreceptor degeneration and severe intraocular inflammation.
Conclusions: :
The amelioration of EAU with microRNA mimics miR-146a and miR-155 treatment suggests that αA crystallin may modulate the expression of these microRNAs which are important regulators of innate and adaptive immune responses targeting TLR4 signaling pathway and cytokine genes of adaptive immune response and apoptotic pathway.Thus, systemic microRNA-based treatment offers a unique approach for suppressing uveitis and preventing photoreceptor damage in uveitis.
Keywords: protective mechanisms • crystallins • photoreceptors