Abstract
Purpose: :
Corneal endothelial cell loss related to aging and dystrophies is associated with significant oxidative stress. Corneal endothelial cells have a very high concentration of mitochondria that is a significant source of reactive oxygen species (ROS). In this study we examined expression and activity of SOD2, the mitochondrial specific superoxide dismutase in rabbit corneal endothelial cells.
Methods: :
SOD2 gene expression in corneal endothelium was examined by RT-PCR and Western blot analysis from fresh and cultured rabbit corneal endothelial (RCE) cells. Two sense and antisense oligonucleotides corresponding to Oryctolagus cuniculus (rabbit) SOD2 mRNA (Genebank ID L28808.1, AAACGTCAGACCTGATTATCT (525-545), AATGTAACTGAAAGATACATG (577-597)) were designed by Ambion siRNA targeting design tool and synthesized using the Silencer siRNA construction kit (Ambion). An siControl nontargeting siRNA (no known mammalian homology) was from Invitrogen. Secondary RCE cells were transfected when 60-80% confluent by using Lipofectamine TM 2000 (Invitrogen) in the presence of 10 nM siSOD2 and siControl, respectively. Cells were harvested 64-68 hours post transfection. SOD2 gene knockdown efficiency was analyzed by Western blot. SOD2 enzyme activity was determined by using a colorimetric method based on a Superoxide Dismutase Assay kit (Cell Technology). KCN was applied to block the activity of SOD1 and SOD3.
Results: :
RT-PCR and Western blot analysis confirmed that SOD2 was expressed in both fresh and cultured rabbit corneal endothelial cells. Western blot results showed that the SOD2 expression was reduced ~90% in secondary RCE cells at 64 hours post transfection by using siSOD2 target AAACGTCAGACCTGATTATCT. This SiSOD2 was selected for use in the remainder of the study. Preparations from siControl treated RCE cells and non-treated cells reduced WST-1 formazan absorbance by 30±5% relative to the blank, whereas preparations from siSOD2 treated RCE cells reduced absorbance by only 6±4%, indicating that SOD2 activity was reduced by ~80% in siSOD2 treated cells.
Conclusions: :
Rabbit corneal endothelial cells express SOD2. Chemical synthesized siSOD2 is capable of knockdown SOD2 expression and enzyme activity in RCE cells efficiently. Knockdown of SOD2 could provide an oxidative stress model for studying reactive oxygen species production and degeneration in RCE cells.
Keywords: cornea: endothelium • oxidation/oxidative or free radical damage • RNAi