Anti-Apoptotic Bcl-2 mRNA Expression and Long-Term Corneal Endothelial Cell Survival Against Oxidative Stress ex vivo: Effect of VIP

Abstract

Purpose:: Corneal endothelial (CE) cell acutocrine vasoactive intestinal peptide (VIP) protects CE cells against the acute killing effects of H₂O₂ ex vivo¹ and switches the death mode from necrosis to apoptosis. The purposes were to demonstrate that the anti-apoptotic Bcl-2 gene expression and the long-term survival of CE cells injured by oxidative stress were promoted by VIP pretreatment, which increased the level of CREB phosphorylation.

Methods:: Bovine corneoscleral explants were conditioned in Eagle's minimal essential medium/ 20 mM HEPES (EMEM/HEPES) at 37^oC for 60 min before CE cells in corneal cups were treated with VIP (0 [control], 10^-10, 10^-8, and 10^-6 M; 15 min). The explants were then treated with 1.4 mM H₂O₂/PBS (30 min, 37 ^oC) and incubated in EMEM/HEPES plus antibiotics for either 26 h, for Bcl2-mRNA quantification, or 64 h, for cell number quantification. Bcl-2 mRNA quantification was done by RTPCR using the Bcl-2 primers (Forward: GAGATGTCCAGTCAGCTGCACC, Reverse: ATAGGCACCCAGGGTGATGC) and kits containing the 18S rRNA primers for normalization of the mRNA levels (Ambion, Catalog #’s 1716 and 1718). The cell number quantification was done by genomic DNA levels using a kit (BioRad). The viability of CE cells in corneoscleral explants was examined by fluorescence microscopy (LIVE/DEAD cytotoxicity assay; Molecular Probes). The state of CREB phosphorylation in CE cells immediately following the VIP pretreatment was demonstrated by Western blot analysis using phosphoCREB antibody (UBI).

Results:: Bcl-2 mRNA levels increased in a VIP-concentration-dependent manner. The ratios of bcl-2:18S were (mean ± SEM): 0.207 ± 0.040, 0.192 ± 0.037, 0.335 ± 0.044*, and 0.456 ± 0.122* in 0, 10^-10, 10^-8, and 10^-6 M VIP-pretreated CE cells, respectively (p<0.05, ANOVA; *: p<0.05 in control vs. VIP-pretreated). CE cells in explants recovering from oxidative stress injury increased in a VIP-concentration-dependent manner and were (in %)100 ± 9, 144 ±26, 190 ± 23*, 166 ± 18*, respectively (p<0.05, ANOVA). VIP dose-dependently increased the level of CREB phosphorylation.

Conclusions:: Through up-regulation of Bcl-2 gene expression, VIP promoted the long-term survival of those CE cells that have survived the initial killing effect of severe oxidative stress.1. Koh and Waschek, (2000) IOVS, 41:4085-4092.

Keywords: apoptosis/cell death • cornea: endothelium • neuropeptides