May 2005
Volume 46, Issue 13
Free
ARVO Annual Meeting Abstract  |   May 2005
The Role of the bcl–2 t(14;18) Translocation in Clinical Outcomes of Primary Intraocular Lymphoma
Author Affiliations & Notes
  • D.J. Wallace
    Duke Univ SOM, Durham, NC
    NEI, Bethesda, MD
  • D. Shen
    NEI, Bethesda, MD
  • G.F. Reed
    NEI, Bethesda, MD
  • M. Mochizuki
    Tokyo Med/Dental Univ, Tokyo, Japan
  • H.N. Sen
    NEI, Bethesda, MD
  • S.S. Dahr
    NEI, Bethesda, MD
  • R.R. Buggage
    NEI, Bethesda, MD
  • R.B. Nussenblatt
    NEI, Bethesda, MD
  • C.C. Chan
    NEI, Bethesda, MD
  • Footnotes
    Commercial Relationships  D.J. Wallace, None; D. Shen, None; G.F. Reed, None; M. Mochizuki, None; H.N. Sen, None; S.S. Dahr, None; R.R. Buggage, None; R.B. Nussenblatt, None; C.C. Chan, None.
  • Footnotes
    Support  NIH Clinical Research Training Program
Investigative Ophthalmology & Visual Science May 2005, Vol.46, 3465. doi:
  • Views
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      D.J. Wallace, D. Shen, G.F. Reed, M. Mochizuki, H.N. Sen, S.S. Dahr, R.R. Buggage, R.B. Nussenblatt, C.C. Chan; The Role of the bcl–2 t(14;18) Translocation in Clinical Outcomes of Primary Intraocular Lymphoma . Invest. Ophthalmol. Vis. Sci. 2005;46(13):3465.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Abstract: : Purpose: Primary intraocular lymphoma (PIOL) is typically a diffuse large B cell lymphoma of the retina, vitreous, or optic nerve head. The bcl–2 t(14;18) translocation brings the bcl–2 gene, an anti–apoptosis gene, under the control of the IgH promoter. This study examined the role of this translocation in PIOL survival and relapse. Methods: From 1991 to 2003, the NEI received ocular specimens from 72 patients with PIOL. Detailed clinical information was available for 23 patients. In order to detect the bcl–2 t(14;18) translocation at the major and minor break points, PCR was performed on DNA from microdissected PIOL cells from vitreous samples. The PCR–amplifiable mixture contained microdissected DNA, 32P–labeled sense primer for Mbr, 5’–TTAGAGAGTTGCTTTACGTGGCCT–3’ or mcr, 5’–GACTCCTTTACGTGCTGGTACC–3’, antisense primer (CFW1), 5’–ACCTGAGGAGACGGTGACCAGGGT–3’, dNTPs, MgCl2, and AmpliTaq Gold Enzyme. The outcome variables of interest included length of survival and relapse. Analysis of survival was made from two–sided Wald statistics from Cox regression analysis using age as a covariate. Relapse was determined by two–sided Wald statistics from the logistic regression analysis using age as a covariate. Results: The clinical course was obtained for 23 patients diagnosed with PIOL. The mean follow up was 29 months. 61% (14/23) had CNS involvement. 77% received radiation, while 51% received methotrexate based therapy (systemic, intravitreal, and intrethecal). Other systemic chemotherapies included vincristine, thiotepa, procarbazine, dexamethasone, Promace, and CHOP. Relapse occurred in 10 (43%) patients. The bcl–2 t(14;18) translocation was detected in 14 (61%) of specimens. Patients who were positive for the translocation were significantly younger (58.9 years vs. 73.9 years) (p = 0.001). After adjusting for age, no statistically significant difference was found in survival (HR = 2.33; p = 0.478) or relapse (OR = 1.28; p = 0.840) between patients who did or did not have the bcl–2 t(14;18) translocation. Conclusions: Studies have found conflicting roles for the bcl–2 t(14;18) translocation in systemic follicular and diffuse large B–cell lymphomas. Our study did not find a role for the bcl–2 t(14;18) translocation in determining length of survival or likelihood of disease relapse in PIOL, although it is interesting to note that patients with the bcl–2 t(14;18) translocation were significantly younger. This may suggest a role for the translocation in accelerating disease presentation and progression.

Keywords: oncology • pathology: human • gene/expression 
×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×