Cloning and Sequencing of Thioredoxin Binding Protein–2 (TBP–2) From Human Lens Epithelial Cells

Abstract

Abstract: : Purpose: This study is to examine the presence of a thioredoxin regulator, thioredoxin binding protein–2 (TBP–2), in human lens epithelial cells and to study its regulatory function. Methods: A cDNA library was prepared from human Lens epithelial cells. Two primers were synthesized (forward primer: GGAATTCGATGGTGATGTTCAAGAAGATC and reverse primer: CCGCTCGAGTCACTGACAATTGTTGTTGA ) for TBP–2 using the known nucleotide sequence of the human brain TBP–2 gene. Reverse transcriptase PCR was carried out using above primers and cDNA library. The product was cloned into pcDNA3.1 (+) vector and analyzed for the presence of the insert and then sequenced. To investigate the expression of TBP–2 and thioredoxin in HLE B3 cells in response to a bolus of 100 µM H₂O₂, the cells were cultured in MEM containing FBS (20%) and grown to a density of 3 X 10⁶ cells per 100mm dish. The cells were weaned from serum by incubating overnight at 2% FBS and 30 min in serum free medium before exposing to H₂O₂. Cells were taken at 0, 5, 10, 15, 20, and 30 min post–H₂O₂ exposure, washed and isolated for total RNAs, which were reverse transcribed. Real–time PCR was performed in triplicate in 96 well plates for quantification of expression of TBP–2, thioredoxin and ß–actin mRNA by using a real–time detection system (Icycler IQ:Biorad). Relative expressions of specific genes were calculated by ^ΔΔCt method. Results: The nucleotide sequence for Human Lens TBP–2 gene (GenBank accession number AY 594328) showed 99% homology with human brain TBP–2. Both thioredoxin and TBP–2 gene expression were transiently increased after H₂O₂ treatment. The expression was highest at 10 min and declined gradually until 30 min when both approached the basal level. Conclusions:We have successfully cloned and sequenced the cDNA for human lens TBP–2. This specific binding protein could be upregulated along with the upregulation of thioredoxin in response to oxidative stress. This indicates that TBP–2 may be a regulator for thioredoxin in human lens epithelial cells, similar to the other cell types.

Keywords: oxidation/oxidative or free radical damage • antioxidants • apoptosis/cell death