Cloning and Expression of Glucocorticoid–Induced TNF Receptor–Related Ligand (GITRL) in Human Retinal Pigment Epithelial Cells

Abstract

Abstract: : Purpose: Recent evidences show that GITR–GITRL interaction plays important role in delivering co–stimulatory signals controlling regulatory T cells. Previous studies from our lab show that GITRL is constitutively expressed at low levels in the retinal pigment epithelium and is upregulated by proinflammatory cytokines. We examine here whether over expression of EYFP–GITRL fusion protein in retinal pigment epithelial cells could be used as a tool in understanding the functional role of GITRL. Methods: Full length GITRL was amplified from a human ovarian cDNA library with human GITRL specific primers GGGGGGAAGCTTGCCACCCCACAGCTCTCATTTCTCC (forward) and GGGGGGAAGCTTGCCACCAAAACTCCGCCTTCCACACCCAC (reverse) .The resulting PCR fragment was purified and subcloned in to a pEYFP–C1 vector. Human adult retinal pigment epithelial cell line ARPE 19 was transfected with the construct pEYFP–C1–GITRL. Expression of EYFP–GITRL fusion protein was examined by confocal microscopy as well as flow cytometry following staining with anti GITRL antibody. Results: We detected the fluorescence of the fusion protein EYFP–GITRL in the cytoplasm of the retinal pigment epithelial cells by confocal microscopy as early as 30 minutes. Peak levels of expression could be seen by 4 hrs. Expression of the fusion protein was seen on the cell surface by 4 hrs and could be seen as late as 48 hrs following transient transfection. This surface expression of membrane bound ligand was confirmed by flow cytometric analysis following staining with anti–GITRL antibody. Conclusions: GITR–GITRL interaction may be important in regulation of ocular inflammation. We present here the characterization of a retinal pigment epithelial cell line over expressing high levels of YFP–GITRL fusion protein following transfection. This could be a valuable tool in understanding the functional role of GITR–GITRL and its role in ocular inflammation.

Keywords: retinal pigment epithelium • immunomodulation/immunoregulation • immune tolerance/privilege