Detection of photoreceptor mitochondrial oxidative stress in EAU prior to the infiltration of macrophages.

Abstract

Abstract: : Purpose: Peroxynitrite (ONOO^–) –mediated photoreceptor degeneration in experimental autoimmune uveitis (EAU) has been attributed to macrophage (MØ) infiltration leading to the generation of highly reactive nitric oxide metabolites. In contrast, we find that peroxynitrite–mediated damage is present prior to MØ infiltration. Here we aim to identify the initial site and source of ONOO^– generation in EAU. Methods: Lewis rats were immunized with S–antigen. The sites of ONOO^– generation in the retina were then detected using 2,7–dihydrodichlorofluorescein diacetate (H₂DCFDA) on days 5, 10 & 14 post–immunization and compared to controls. Mitochondria were labeled with Mito Tracker Deep Red, and sections were examined by confocal microscopy. MØ infiltration was evaluated by immunohistochemistry. Inducible nitric oxide synthetase (iNOS) was located using immunohistochemistry and confocal microscopy, and its expression was determined by RT–PCR. The primers used for PCR were iNOS forward 5’CCACAATAGTACAATACTACTTGG–3’and reverse 5’ACGAGGTGTTCAGCGTGCTCCACG–3’, amplifying 395–bp products. Results: Co–localization of dichlorofluorescein (DCF) with Mito Tracker Deep Red was marked within the photoreceptor inner segments. The ratio of DCF: Mito Tracker Deep Red fluorescence was significantly increased in day 5 EAU retina when compared with control retina. Day 5 EAU retinas were negative for MØ infiltration. A two fold increase in iNOS mRNA expression was present in day 5 EAU, when compared to the control retina (P< 0.05). Immunohistochemistry showed that this increase was particularly pronounced at the photoreceptor inner segments, the outer plexiform layer, and the RPE. By day 10 post–immunization, MØ infiltration had occurred and a three fold increase in iNOS was detected, when compared to the control retina (P< 0.05). Conclusions: The above results demonstrate that upregulation of iNOS and generation of ONOO^– initially occurs within the photoreceptor mitochondria in day 5 EAU retina.This occurs prior to the infiltration of macrophages. These novel observations suggest that photoreceptor mitochondrial oxidative stress may initiate infiltration of macrophages, leading to amplification of EAU.

Keywords: autoimmune disease • oxidation/oxidative or free radical damage • uveitis–clinical/animal model