LOXL1 Hypermethylation in Pseudoexfoliation Syndrome in the Uighur Population

Abstract

Purpose: High prevalence of pseudoexfoliation syndrome (PEX) occurs in the Uighur population. This study investigated DNA methylation of the lysyloxidase-like 1 (LOXL1) gene in Uighur PEX patients with cataracts.

Methods: The research involved 10 lens capsule specimens from Uighur PEX patients with cataracts and 10 lens capsule specimens from Uighur control patients with age-related cataract (ARC) alone. All specimens were freshly collected during cataract surgery. Methylation status of the CpG islands was analyzed using pyrosequencing. The mRNA levels of LOXL1 were evaluated by quantitative real-time PCR, and protein levels were evaluated by Western blot assay.

Results: For all the six chosen CpG islands of the LOXL1 gene promoter, hypermethylation was found in the PEX with cataracts compared to the age-matched ARC group. At the same time, the expression level of LOXL1 mRNA was significantly reduced in the PEX with cataracts group than that in the ARC group, and the expression level of the LOXL1 protein product demonstrated a similar tendency.

Conclusions: The susceptible PEX gene LOXL1 undergoes DNA hypermethylation in its promoter region in Uighur PEX with cataracts patients. This indicates that epigenetic regulation might play roles in PEX pathogenesis.

Pseudoexfoliation syndrome (PEX) is an age-related systematic disease involving the abnormal production, deposition, and turnover of pseudoexfoliation material (PXM) in connective tissue and skin all over the body. In the eye, PEX has numerous ocular manifestations, including secondary open-angle glaucoma, lens zonular weakness, and cataract pathogenesis. As initially described by Lindberg in 1917,¹ PEX is characterized by white, flake-like PXM deposited on the pupillary border and anterior lens capsule, appearing in a typical double concentric ring pattern.² 

The prevalence of PEX varies greatly across regions and populations and increases with age. High prevalence has been reported in some European countries, with rates higher than 20%.^3–5 In the southern United States, the prevalence is approximately 5.0% in individuals between 75 and 85 years of age.⁶ In Asian populations, such as Indian,⁷ Japanese,⁸ Hong Kong Chinese,⁹ and Singaporean Chinese,¹⁰ the prevalence is less than 5.0%. In China, this ethnic and geographic pattern is remarkable. In a recent study¹¹ that targeted Han individuals over 50 years of age in northern mainland China, the prevalence of PEX was 2.38%. In contrast, in the Uighur population, the prevalence is 5.1% in Kashi Uighur¹² and 2.2% and 9.5% in Kuche Uighur in individuals 60 and 80 years of age, respectively.¹³ 

Much about the pathogenesis of PEX remains unclear. According to strong racial differences and family aggregation, in its manifestation, studies worldwide have shown that genetic factors play a crucial role. The product of the lysyl oxidase-like 1 (LOXL1) gene belongs to a family of lysyl oxidase enzymes that are responsible for the biogenesis, maintenance, and remodeling of elastin fibers and the regulation of crosslinking between collagen and elastin in connective tissues.¹⁴ Researchers have also found that LOXL1 is a component of PXM localized around fibrous protein aggregates on the lens capsule surface in patients with PEX.¹⁵ Recently, Thorfeifsson et al.¹⁶ performed a genome-wide association study in Icelandic and Swedish populations and identified three single-nucleotide polymorphisms (SNPs) of the LOXL1 gene associated with PEX. Subsequent studies replicated this association in Caucasian populations in the United States,¹⁷ Australia,¹⁸ Europe,¹⁹ and other ethnic groups, including Indian,²⁰ Korean,²¹ and Japanese,²² as well as Chinese²³ and Uighur²⁴ populations. Based on these studies, LOXL1 is the most common of the susceptible genes. In addition, the remarkable geographic distribution of differences suggests that environmental factors play a role in the natural history of PEX. Ambient temperature and sunlight exposure are potential risks.²⁵ Virus infection, autoimmunity,²⁶ and nutrition²⁷ are also involved in triggering PEX. 

Epigenetics is the study of heritable and reversible changes in gene activity in the absence of a change in DNA sequence. Epigenetic phenomena occur mainly at two levels: DNA methylation and histone modification.²⁸ By adding a methyl group to cytosine in the DNA sequence, DNA methylation alters the electrostatic nature of chromatin and DNA affinity with transcription factors, which ultimately induces silencing of gene expression.²⁹ As we recently reported, hypermethylation of the CpG islands in the promoter of the CRYAA gene was found in age-related cataract (ARC)³⁰ and high myopic cataract (HMC) eyes,³¹ and expression of the gene's encoded protein, αA-crystallin, was significantly decreased compared with that in healthy control eyes. These results demonstrated that epigenetic regulation is involved in cataract formation. 

In China, Uighurs are officially recognized as one of 55 minority nationalities and total approximately 9.41 million population. They live primarily in the Xinjiang Autonomous Region located in northwest China. A semiarid or desert climate prevails in this region, with the longest day length, second-highest amount of sunlight exposure, and less precipitation than occurs in the rest of China. Based on the remarkable ethnic and geographic distribution of PEX in the Uighur population, as well as research conclusions, we hypothesized that hypermethylation of CpG islands in the promoter of the LOXL1 gene underlies the genesis and development of PEX. In this study, we analyzed DNA methylation by pyrosequencing the CpG islands in the LOXL1 promoter and compared LOXL1 expression between patients with PEX with cataracts (PEX-C) and patients with simple ARC in a Uighur population. 

Methods

Clinical Data and Lens Capsule Sample Collection

Ten patients with PEX-C and 10 patients with simple ARC were involved in our research. All patients were from the Uighur population and visited the second People's Hospital of Kashi, Xinjiang, for cataract surgery. Routine ophthalmic examinations were carried out. For the patients with PEX-C, diagnosis of PEX was based on the presence of PXM on the anterior lens capsule. In addition, according to the PEX-C staging method in our recent clinical study,³² these patients were in the middle stage, with lens nuclear opacity in the NO 3 grade (The Lens Opacities Classification System III, LOCS III) and with moderate PXM deposits. Lenses in patients with simple ARC were also identified as nuclear cataracts and graded as NO 3 using the LOCS III system (Fig. 1). Neither loss of visual field nor optic nerve damage was found in patients with PEX-C or ARC. None of the patients received any form of glaucoma medication. Fresh lens anterior capsule membrane samples were obtained with intact continuous curvilinear capsulorhexis during cataract surgery, without vascular contact or damage to other intraocular structures, and were immediately stored at −80°C until analysis. All samples were collected after written informed consent was obtained from the patients; the consent procedure had been previously approved by the ethics committee of the Eye and ENT Hospital of Fudan University. All procedures adhered to the Declaration of Helsinki tenets for experiments involving human tissue and samples. 

Figure 1

 

Anterior segment views of patients in (A) the simple ARC group and (B) the PEX-C syndrome group.

Pyrosequencing

The promoter region of the LOXL1 gene was analyzed using the PyroMark assay design (Venlo; Qiagen, Limburg, The Netherlands), and six CpG islands were chosen. After bisulfite conversion, pyrosequencing was performed as previously described.³³ Polymerase chain reaction (PCR) was carried out with 0.2 M of each biotin primer (forward: TGGAGGTAGTTGATTTAGTGGGAGAATA; reverse: ACAACACCCCAAAACTACTCT). PCR products were bound to Streptavidin sepharose high performance chromatography medium (Amersham Biosciences, Uppsala, Sweden). Sepharose beads containing the immobilized PCR products were purified, washed, and denatured using a solution of 0.2 M NaOH and rewashed using the Pyrosequencing vacuum preparation tool (Qiagen). Next, a 0.5 μM pyrosequencing primer (GGTAGGTGTATAGTTTGTTTAA) was annealed to the purified single-stranded PCR products, and then 10 μL of the PCR products was sequenced using the Pyrosequencing PSQ 96 HS system (Qiagen). The methylation status of each locus was analyzed individually as a ratio of thymine to cytosine (T/C) SNP, using Pyro-QCpG software (Qiagen) and expressed as a percentage. 

Relative Quantitative Real-Time PCR

As described previously,³¹ real-time PCR was performed to evaluate the mRNA level of the LOXL1 gene. Total RNA was extracted from each lens capsule sample using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from 1 μg of total RNA with reverse transcription, using oligo(dT)18 primer (Invitrogen) and Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. Primer sequences for LOXL1 and β-actin are shown in Table 1. Real-time PCR reactions were performed with SYBR Premix Ex Taq (Takara, Otsu, Japan). The housekeeping gene β-actin (ACTB) was used as an internal standard to normalize mRNA expression of the LOXL1 gene. Relative multiples of changes in mRNA expression were determined by calculating the 2^−△△Ct. 

Table 1

 

Primers Used for Quantitative Real-Time PCR

 

Western Blotting Assay

Western blot analysis was performed as previously described.³⁴ Samples were washed in cold phosphate-buffered saline, lysed with extraction buffer, and centrifuged at 12,000 rpm for 10 minutes. Protein concentrations of the supernatant were determined using a protein assay kit (Bio-Rad, Hercules, CA, USA). Soluble proteins were loaded and separated with 10% SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). Membranes were probed with primary antibodies for LOXL1 (1:1000 dilution; Santa Cruz Biotechnology, Dallas, TX, USA) and β-actin (Sigma-Aldrich, Munich, Germany) by overnight incubation at 4°C. After samples were incubated with a horseradish peroxidase-conjugated secondary antibody (1:5000 dilution; Abmart, Shanghai, China) for 1 hour at room temperature, the images were developed using a chemiluminescence detection solution (Thermo Scientific, Rockford, IL, USA). 

Statistical Analysis

Results are means ± standard deviations (SD). Statistical significance between groups was assessed using the Student t-test. A P value of <0.05 was considered significant. 

Results

General Characteristics

Patients' baseline characteristics are shown in Table 2. For all listed categories, there were no statistically significant differences between the PEX-C group and the simple ARC group (all P > 0.05). 

Table 2

 

Baseline Characteristic Data

 

Methylation Status of the LOXL1 Promoter

To determine the single-base variations caused by CpG methylation, pyrosequencing, a real-time DNA sequencing method, was used to evaluate the promoter region of the LOXL1 gene in both groups. As shown in Figure 2, for each of the six selected CpG islands, hypermethylation was found in the PEX-C group compared with the simple ARC group (P < 0.05 at each site). The total methylation rate (average rate of the six selected CpG islands) was also significantly greater in the PEX-C group (22.56% ± 0.75%) than in the simple ARC group (2.06% ± 1.42%; t, −22.105; P = 0.000). 

Figure 2

 

Methylation of the LOXL1 gene was measured using pyrosequencing. CpG island methylation in the LOXL1 promoter was significantly greater in the PEX-C group than in the ARC group. (A) Representative pyrosequencing results of the PEX-C group and ARC group. (B) The six selected CpG islands in the PEX-C group showed hypermethylation (22.56 ± 0.75%) compared with those in the control group (2.06 ± 1.42%), *P  = 0.000. (C) Percentage of methylation is shown at each individual CpG site in each group; P = 0.049, 0.014, 0.001, 0.001, 0.002, and 0.000 at CpG sites 1 to 6, respectively.

Expression of LOXL1 at the mRNA Level

To evaluate LOXL1 gene expression in lens capsules, mRNA levels of LOXL1 in the PEX-C group and in the simple ARC group were measured. As the results of real-time PCR shown in Figure 3, the LOXL1 mRNA level in the PEX-C group decreased to 47.13% of that in the simple ARC group (P < 0.005). 

Figure 3

 

LOXL1 mRNA expression in the anterior lens capsule of each group was detected using quantitative real-time PCR analysis. LOXL1 mRNA expression was significantly lower in the PEX-C group than in the ARC group, normalized against that of the β-actin (ACTB) gene as the internal control. Quantitative real-time PCR was performed 3 times, and values are the means ± SD of these 3 separate experiments. *P < 0.005.

Expression of LOXL1 at the Protein Level

In addition to identifying expression of the LOXL1 gene at the protein level, Western blot analysis was carried out, and the same tendency was observed. As indicated in Figure 4, the level of the LOXL1 protein product was significantly lower in the PEX-C group than in the simple ARC group. 

Figure 4

 

LOXL1 protein levels in anterior lens capsules were determined using Western blot analysis. Expression of LOXL1 in the PEX-C group was found to be decreased compared to that in the ARC group. Equal loading of samples was verified with immunodetection of β-actin.

Discussion

Pseudoexfoliation syndrome is a late-onset, systemic, multifactorial disease involving elastic microfibrillopathy in intraocular and extraocular tissues.¹ It is clinically complicated with open-angle glaucoma, cataract formation, and lens subluxation, and eyes with PEX are at higher risk for developing cataracts.^35,36 PXM deposited in the skin and connective tissue of visceral organs also leads to systematic diseases, such as aortic aneurysm and dementia.^37,38 The Uighur population in China is a Caucasian population. The prevalence of PEX in China is much higher in the Uighur population than that in the Han population, which demonstrates that PEX has a notable ethnic feature.¹³ This corresponds with recent worldwide studies showing that genetic factors play an important role in the pathogenesis of PEX.^16,39 Furthermore, PEX in the Uighur population also presents a geographic feature. The Xinjiang Autonomous Region, in which Uighur individuals live, experiences the typical features of a semiarid to desert climate with adequate sunlight and little precipitation, corresponding to recent conclusions that emphasize the dependence of PEX prevalence on geographic features and environmental triggers such as temperature and sun exposure.⁴⁰ The Uighur subjects we recruited in the present study were from Kashi, which is located south of the Tianshan Mountains in the Xinjiang Autonomous Region. All subjects were farmers, whose daily activities included outdoor herding and farming. These ideal subjects presented both ethnic and geographic features. In addition, in our clinical research, we observed an interesting phenomenon (not published) showing that, for Uighur cataract patients in Kashi, PEX is more common among farmers than among individuals living in urban areas. Moreover, for cataract patients from the Han population, the prevalence of PEX is also higher in Kashi than that in the interior regions of China. All these observations indicate that, together with genetic factors, geographic, environmental, and climate factors also may play important roles in the pathogenesis of cataracts with PEX. 

Epigenetic effects regulate gene expression patterns through mitotic and meiotic division without changing the DNA sequence, and the epigenome is responsive to developmental, physiological, and environmental information. This explains how the environment and other factors mediate the phenome without affecting the genome throughout the subject's lifespan, and epigenetic effects are considered the link between genetic and nongenetic factors. Recent studies demonstrated that many eye diseases, including glaucoma,⁴¹ age-related macular degeneration,⁴² uveal melanoma,⁴³ and diabetic retinopathy,⁴⁴ are associated with epigenetic regulation. As for the lens, our team reported for the first time that hypermethylation occurs in the promoter CpG islands of the CRYAA gene in patients with ARC, leading to a significant decrease in αA-crystallin expression.³⁰ Treating lens epithelial cells with zebularine, a demethylating agent, can restore this downregulation effect of DNA hypermethylation. A subsequent study³¹ focusing on HMC eyes, revealed that more severe nuclear cataracts in patients with HMC present higher methylation of the CRYAA gene and lower expression of αA-crystallin expression; this tendency is also found in comparison with simple ARC patients. These results indicated that epigenetic regulation plays a potential role in the pathogenesis of cataracts. Consequently, we wondered whether epigenetic regulation also functions in other lens-related eye diseases. The LOXL1 gene is reported to be the most susceptible gene related to PEX,^16–24 and it plays a generalized and essential role in elastic fiber homeostasis, particularly during dynamic processes such as tissue injury, fibrosis, and development. Because LOXL1 and elastin have been detected in various ocular tissues, the dysregulated expression of LOXL1 might be associated with PEX pathogenesis. Therefore, we wondered whether the epigenetic regulation of LOXL1 expression also functioned in the pathogenesis of PEX in the present study. We chose lens anterior capsules of PEX with cataract patients as ideal research material because the capsule is exposed to external environmental factors over an entire lifetime through the pupil. We found that the increased DNA methylation of the LOXL1 gene causes downregulation of gene expression in patients with PEX-C compared with that in patients with simple ARC. Real-time PCR and Western blotting results confirmed that the levels of mRNA and protein expression in LOXL1 decreased significantly in the anterior lens capsule epithelial cells in PEX cataracts. Pyrosequencing results showed that the methylation rate of the CpG islands in the promoter region of the LOXL1 gene increased in this group. Overall, our findings suggest that downregulation of the LOXL1 gene is associated with increased DNA methylation, which is involved in the formation and development of PEX. 

In addition to epigenetic regulation, many factors are involved in modulating levels of LOXL1 expression. Pascual et al.⁴⁵ reported that LOXL and tropoelastin, markers of elastin synthesis, diminish with age, suggesting that age plays a role in the negative regulation of LOXL1 expression. In PEX cases, LOXL1 presented differential expression levels depending on the progression stage of the fibrotic process, regardless of the presence of glaucoma: Schlötzer-Schrehardt et al.⁴⁶ stated that LOXL1 was transiently and significantly upregulated in the early stage of PEX but decreased below normal homeostatic level in the advanced stage. They explained that LOXL1 upregulation is actively involved in PXM formation, because the PXM deposits are the main feature of this stage, and LOXL1 accumulates on the surface of PXM-producing cells and immediately associates with microfibrillar structures to form PEX fibrils. They also surmised that the decreased expression of LOXL1 in the later PEX stage was compensation for the LOXL1 accumulation in the early stage, which would in turn disrupt elastin homeostasis and alter elastotic characteristic in tissues. 

In our samples, differences in ages were not statistically significant between the two groups (Table 2). In addition, although no standard method was reached for distinguishing PEX stages, in our recent clinical study,³² we designed a staging method by evaluating a large sample of patients with PEX with cataracts in the Uighur population and dividing them into early, middle, and late stages depending on lens opacity grade, amount of PXM on the crystalline lens and iris, as well as the patients' visual acuity. According to this method, cases in the PEX-C group of the present study were in the middle stage, with lens nuclear opacity in the NO 3 grade (LOCS III system) with moderate PXM deposits; visual acuity between the two groups was similar. Therefore, age and PEX stage were excluded as causes of differences in LOXL1 expression between the two groups in this study. 

SNPs are highly associated with the pathogenesis of PEX, which may also modulate the expression level of LOXL1. Among the SNPs most reported in PEX populations,^23,47,48 Kuhlenbäumer et al.⁴⁹ reported that the risk alleles of rs1048661 (R141L) were relevant with decreased ocular LOXL1 expression levels. Mayinu et al.²⁴ confirmed this association, and they further proved that the frequency of risk alleles was higher at rs1048661 in patients with PEX who were younger than 65 years of age, whereas in patients who were older than 65 years of age, the frequency was higher at rs3825942 (G153D), which would not affect the expression level of LOXL1. In the present study, we did not analyze the genotype of our specimens due to the limited quantities of anterior lens capsules during phacoemulsification. Our subjects in the PEX-C and simple ARC groups were over 65 years of age, suggesting that, even if SNPs played a part in the PEX pathogenesis of our patients, there was a higher probability that our PEX specimens would contain SNP rs3825942 (G153D), which would not impact the expression level of LOXL1. Therefore, we surmise that the downregulation of LOXL1 expression in the levels of mRNA and protein is the direct effect of DNA hypermethylation in this gene. 

In summary, our results indicate that hypermethylation of CpG islands in the promoter region of the LOXL1 gene leads directly to downregulation of LOXL1 mRNA and protein, which functions as an essential mechanism in the pathogenesis of PEX. This study raises a novel understanding of the causes of PEX from the epigenetic aspect, which links genetic variation to nongenetic predisposing factors, setting the stage for development and progression of this disease. 

Acknowledgments

The authors thank Fan Zhang, Miershali Wubuli, Wei Gao, and Xuemei Li (Department of Ophthalmology, Second People's Hospital of Kashi, Xinjiang Uighur Autonomous Region) for collecting cases and specimens for this study. 

This study was presented orally at the annual meeting of the Association for Research in Vision and Ophthalmology, Orlando, Florida, United States, May 7, 2014. 

Supported by National Nature Science Foundation of China grant 81270989, Shanghai Science and Technology Committee Foundation grant 124119a9900, and by an ARVO international travel grant to Hongfei Ye. 

Disclosure: H. Ye, None; Y. Jiang, None; Q. Jing, None; D. Li, None; T. Maimaiti, None; D. Kasimu, None; Y. Lu, None