Sirtuin Type 1 Mediates the Retinal Protective Effect of Hydrogen-Rich Saline Against Light-Induced Damage in Rats

Abstract

Purpose: Molecular hydrogen has been used as an antioxidant to treat many diseases in clinical and animal studies. However, the therapeutic mechanism of molecular hydrogen remains unclear. We previously reported mitigation of light-induced damage in the rat retina by intraperitoneal injection of hydrogen-rich saline (HRS). In the present study, we investigated whether Sirtuin Type 1 (Sirt1), a class III histone deacetylase, mediates the retinal protective effect of HRS in rats with light-induced retinal damage.

Methods: Rats were treated with HRS for 5 days after intense light exposure, and then ERGs were performed and retinas were collected to evaluate the effect of HRS on Sirt1 expression. The necessity of Sirt1 for the retinal protective effect of HRS was investigated using the Sirt1 activator resveratrol, the Sirt1 inhibitor EX-527, and short interfering RNAs.

Results: In light-damaged retinas, 5 days of HRS treatment increased Sirt1 expression, mitigated a- and b-wave amplitude reduction, and decreased the reduction of outer nuclear cell layers. The Sirt1 activator resveratrol mimicked the effect of HRS in light-damaged retinas. This result supported our hypothesis that Sirt1 mediates the protective effect of HRS. Additionally, the retinal protective effect of HRS was inhibited by both the Sirt1 inhibitor EX-527 and Sirt1 targeted short interfering RNAs. Hydrogen-rich saline also increased B-cell lymphoma 2 (Bcl-2) expression and the activity of the antioxidant enzyme superoxide dismutase (SOD). Conversely, HRS decreased Bcl2-associated X protein expression, cleaved caspase-3, and oxidant-stress product malondialdehyde (MDA) in a Sirt1-dependent manner.

Conclusions: Sirt1 mediates light-induced damage mitigation by HRS through inhibition of apoptosis and oxidant-stress.

Intense light exposure can cause photoreceptor degeneration. Furthermore, accumulated light-induced damage may contribute to AMD, a globally important retinal degenerative disease that causes blindness.¹ Although the pathogenesis of light-induced retinal damage remains unclear, oxidative stress is likely involved.^2,3 Antioxidants have been used to prevent light-induced damage.^3–5 Therefore, antioxidants capable of easily passing the blood–retinal barrier could be a promising treatment for light-induced damage. 

Molecular hydrogen (H₂) has been successfully developed as a therapeutic molecule. H₂ has been demonstrated to scavenge hydroxyl radicals and increase antioxidant enzyme activity in many diseases, including schistosomiasis-related chronic liver inflammation,⁶ Parkinson's disease,^7,8 ischemia-reperfusion injury,^9,10 and diabetes.^11,12 A long-term study of H₂ exposure in deep sea divers observed no toxic or adverse effects related to H₂ exposure.¹³ There is growing evidence that H₂ plays important roles in reactive oxygen species (ROS) reduction,¹⁴ inflammation inhibition,^6,15 metabolism regulation,^12,16 and apoptosis inhibition.^17–19 We previously reported that hydrogen-rich saline (HRS) reduces light-induced retinal damage in rats.²⁰ However, the mechanisms underlying the observed retinal protection have not been fully elucidated. 

Sirtuin Type 1 (Sirt1), is a histone deacetylase belonging to the sirtuin family. Sirt1 reportedly participates in stress response pathways,^21–23 apoptosis,^24,25 inflammation,²⁶ and metabolism.²⁷ Sirt1 is expressed in normal ocular structures, including the cornea, lens, iris, ciliary body, and retina.²⁸ Furthermore, Sirt1 has been associated with various retinal diseases, including diabetic retinopathy,²⁹ AMD,³⁰ and retinal degeneration.²⁸ Therefore, Sirt1 appears to be an important protector of retinal health.^31,32 Supporting this hypothesis, it has been reported that Sirt1 participates in the light-induced retinal damage response.^30,33 Furthermore, Sirt1 activation by resveratrol reduces the light-induced apoptosis response of retinal outer layer cells.³³ Sirt1 also reportedly increases cell survival during oxidative stress by upregulating expression of catalase and manganese superoxide dismutase.³⁴ It remains unclear whether Sirt1 mediates retinal protection through HRS. 

In this study, we used a rat model of light-induced retinal damage to examine Sirt1 expression after HRS treatment and assess Sirt1's potential role in HRS-mediated retinal protection. We aimed to investigate whether Sirt1 mediates HRS retinal protection, and to identify the mechanisms underlying retinal protection by H₂. 

Materials and Methods

Animals

Male Sprague–Dawley rats (6- to 7-weeks-old, weighing 200–220 g) were obtained from the Laboratory Animal Center of the Fourth Military Medical University (Xi'an, China). All animal experiments were carried out in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Furthermore, all experiments were approved by the Animal Care and Use Committee of the Fourth Military Medical University. All animals were kept under dim cyclic light (5 lux, 12 hour on/off, 6 AM–6 PM), with food and water available ad libitum. 

The Sprague-Dawley rats were used to study the effect of HRS on total superoxide dismutase (total-SOD) activity, malondialdehyde (MDA) levels, and Sirt1, caspase-3, Bax, and Bcl-2 expression. 

To study the effect of HRS, rats were randomly divided into the following four groups (n = 6 per group): (1) a control group receiving no light exposure or treatment, (2) a light exposure (LE) group receiving intense LE, but no treatment, (3) an LE+vehicle group receiving LE and normal saline, and (4) an LE+HRS group receiving LE and HRS. 

To study the effect of resveratrol on light-induced retinal damage, rats were randomly assigned into four groups (n = 6 per group): (1) an LE group, (2) an LE+HRS group receiving LE and HRS, (3) an LE+ transresveratrol (REV) group receiving LE and resveratrol, and (4) an LE+vehicle group receiving LE and vehicle (dimethyl sulfoxide [DMSO] in PBS). 

To study the effect of EX-527 on HRS light-induced retinal damage protection, rats were randomly assigned into four groups (n = 6 per group): (1) an LE group, (2) an LE+HRS group receiving LE and HRS, (3) an LE+EX-527+HRS group receiving LE, HRS, and EX-527, and (4) an LE+vehicle+HRS group receiving LE, HRS, and vehicle (DMSO). 

To study the effect of Sirt1 targeting short interfering RNAs (siRNAs) on HRS-mediated protection from light-induced retinal damage, rats were randomly assigned into four groups (n = 6 per group): (1) an LE group, (2) an LE+HRS group receiving LE and HRS, (3) an LE+siRNA-Sirt1+HRS group receiving LE, HRS, and Sirt1 siRNA, and (4) an LE+vehicle+HRS group receiving LE, HRS, and diethylpyrocarbonate (DEPC) water. 

To study the effect of HRS on light-induced apoptosis and oxidant-stress, rats were randomly assigned into six groups (n = 6 per group): (1) an LE group, (2) an LE+HRS group receiving LE and HRS, (3) an LE+REV group receiving LE and resveratrol, (4) an LE+DMSO+PBS group receiving LE and DMSO in PBS, (5) an LE+siRNA-Sirt1+HRS group receiving LE, HRS, and Sirt1 siRNA, and (6) an LE+DEPC water+HRS group receiving LE, HRS, and DEPC water. 

Light Exposure

Light exposure was performed as described in our previous study.²⁰ Briefly, rats were dark-adapted for 12 hours, and then the rat's pupils were dilated with 0.5% tropicamide-phenylephrine ophthalmic solution (H20055546; Shenyang Xingqi Pharmaceutical Co., Ltd., Shenyang, China). Rats were then exposed to 10000 ± 100 lux white light-emitting diode (LED) light for 3 hours. The environment was kept between 24°C and 26°C and the light exposure experiments were performed between 6 PM and 6 AM the next day. Immediately following the exposure period, rats were returned to dim cyclic light conditions (5 lux, 12 hours on/off). 

HRS Preparation and Treatment

Hydrogen-rich saline was produced as described previously.²⁰ Briefly, hydrogen was dissolved in normal saline for 6 hours under 0.4 MPa pressure to obtain supersaturated HRS. After preparation, HRS was stored at 4°C and normal atmospheric pressure in an airtight aluminum bag with no dead volume. Hydrogen-rich saline was freshly prepared every week to ensure a hydrogen concentration above 0.6 mM. Ohsawa's gas chromatography method was used to confirm the hydrogen concentration.⁹ Beginning immediately after light exposure, rats were intraperitoneally injected with HRS (5 mL/mg) or vehicle (normal saline) once daily for 5 days. 

Administration of Sirt1 Activator or Inhibitor

The Sirt1 activator REV (Lot no. 70675; Cayman Chemical, Ann Arbor, MI, USA) was dissolved in DMSO and diluted with PBS. Transresveratrol (or the same volume of vehicle) was administered intragastrically (50 mg/kg) as previously described.³³ The Sirt1 specific inhibitor EX-527 (Lot No. 10009798; Cayman Chemical) was dissolved in DMSO at a concentration of 5 μg/μl. Rats received intravitreal injections of 10 μg EX-527 or the same volume of vehicle, as previously reported.³⁵ Transresveratrol or EX-527 was given immediately after light exposure. EX-527 was given every 36 hours for 5 days, and REV was administrated daily for 5 days. 

Intravitreal Injection of siRNA

Sirt1 siRNA was prepared according to a standard commercial protocol. Briefly, 5 nmol Sirt1 siRNA (Lot no. siM14612161601; Ribobio, Guangzhou, China) was centrifuged at 825g for 5 minutes, and then dissolved in 5 μL DEPC water. Rats were anaesthetized with an intraperitoneal injection of 10% chloral hydrate (3 mL/kg, Lot no. c8383; Sigma-Aldrich Corp., St. Louis, MO, USA), and then 2 μL siRNA or DEPC water was intravitreally injected into both eyes of each rat as previously described.³⁶ After injections, ofloxacin ointment (Lot No. H10940177; Shenyang Xingqi Pharmaceutical Co., Ltd.) was used to prevent infection. siRNA and DEPC water injections were administered 12 hours before and 3 days after light exposure. 

Electroretinography

Electroretinography (ERG) was performed 5 days after the start of light exposure as previously described.²⁰ Briefly, after 12-hour dark adaption, rats were anaesthetized with an intraperitoneal injection of 1% sodium pentobarbital (3 mL/kg, Lot No. p3761; Sigma-Aldrich Corp.) and sumianxin II (0.05 mL, Jilin Shengda Animal Pharmaceutical Co., Ltd., Jilin, China). Tropicamide-phenylephrine ophthalmic solution (0.5%) was used to dilate the pupils. Electroretinographs were recorded by placing a silver-chloride electrode loop encased in a layer of 1% methylcellulose on the cornea. Stainless steel electrodes in the tail and cheek served as ground and reference leads, respectively. Full-field (Ganzfeld) stimulation was applied and ERGs were recorded with a commercial system (RETI port; Roland Consult GmbH, Brandenburg, Germany) with a band pass of 0.5 to 1000 Hz. Scotopic conditions of 0.01 and 3.0 cd.s.m⁻² ERG, and photopic conditions of 3.0 cd.s.m⁻² ERG were recorded. The b-wave amplitude of each ERGs and a-wave amplitude of scotopic conditions of 3.0 cd.s.m⁻² ERG were analyzed. 

Measurement of Retinal Outer Nuclear Layer (ONL) Cell Layer Number

Five days after exposure, rats were intraperitoneally anesthetized with 10% chloral hydrate (3 mL/kg, Lot no. c8383; Sigma-Aldrich). Eyes were enucleated and immediately frozen in a Tissue-Tek O.C.T. compound (SAKURA, Torrance, CA, USA). Retinal sections (10 μm) were fixed in cold acetone and stained with hematoxylin and eosin (H&E). Images were captured using a digital imaging system (Olympus, Tokyo, Japan) for each section. The ONL cell layer number was determined by counting the nuclei in the ONL along the line vertical to the RPE. The layer number was measured at 0.4 to 0.5 mm, starting from the optic nerve head to the peripheral area. 

Western Blotting

Rat retinas were homogenized on ice in RIPA buffer (150 mM NaCl, 1% NP-40, 0.5% desoxycholic acid, 0.1% SDS, and 50 mM Tris, pH 8). Lysates were then centrifuged at 12,000 g and 4°C for 30 minutes. Supernatant protein concentration was determined using a BCA protein assay kit (CW0014; Cwbio, Shanghai, China). Equal amounts of protein (30 μg of each sample) were loaded, separated by 10% SDS-PAGE and transferred onto nitrocellulose membranes. Membranes were incubated with primary antibodies against Sirt1 (ab110304, mouse anti-rat monoclonal antibody, 1:1000; Abcam, Cambridge, MA, USA), caspase-3 (#9662, rabbit anti-rat polyclonal antibody, 1:1000; Cell Signaling Technology, Beverly, MA, USA), β-actin (#4970, rabbit anti-rat monoclonal antibody, 1:1000; Cell Signaling Technology), and β-tubulin (#2128, rabbit anti-rat monoclonal antibody, 1:1000; Cell Signaling Technology, USA) at 4°C overnight. After washing with PBS, membranes were incubated with goat anti-rabbit IgG or goat anti-mouse HRP-conjugated secondary antibodies (ab97051, ab97023, 1:10000; Abcam) at room temperature for 1 hour. An enhanced chemiluminescence system (Thermo Fisher Scientific, Waltham, MA, USA) was used to detect the protein band. The intensity of each protein band was determined using ImageJ software (http://imagej.nih.gov/ij/; provided in the public domain by the National Institutes of Health, Bethesda, MD, USA). β-tubulin or β-actin was used as the loading control. 

Real-Time RT-PCR

Total RNA was extracted from rat retinas using RNAiso Plus (TaKaRa Bio, Otsu, Shiga, Japan). RNA (1 μg) from each sample was reverse transcribed into single-stranded complementary DNA using a Transcriptor First Stand cDNA Synthesis Kit (Roche, Mannheim, Germany) according to the manufacturer's instructions. Amplification and quantification were carried out in a 20 μL reaction mixture containing 10 μL 2× FastStart Universal SYBR Green Master Mix (Roche), 1 μL cDNA, 1 μL primers and 8 μL ddH₂O. The reaction conditions were as follows: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 58°C for 15 seconds, and 72°C for 15 seconds; 72°C for 8 minutes. The primers used in quantitative real-time PCR were: 

•  
  Sirt1
•  
  1.  
     5′ - GACGCCTTATCCTCTAGTTCCTG - 3′ (forward)
  2.  
     5′ - GCTTCATTAACTGCCTCTTGATCC - 3′ (reverse);
•  
  Bcl-2
•  
  1.  
     5′ - GGACAACATCGCTCTGTGGATGA - 3′ (forward)
  2.  
     5′ - CAGAGACAGCCAGGAGAAATCAA - 3′ (reverse);
•  
  Bax
•  
  1.  
     5′ - AGCTCTGAACAGATCATGAAGACA - 3′ (forward)
  2.  
     5′ - CTCCATGTTGTTGTCCAGTTCATC - 3′ (reverse);
•  
  β-actin
•  
  1.  
     5′ - CTTCCTCCCTGGAGAAGAGCTATG - 3′ (forward)
  2.  
     5′ - CCAAGAAGGAAGGCTGGAAAAGAG - 3′ (reserve);
•  
  GAPDH
•  
  1.  
     5′ - TGACCTCAACTACATGGTCTACATG - 3′ (forward)
  2.  
     5′ - CCAGTAGACTCCACGACATACTCA - 3′ (reserve); and
•  
  Hprt1
•  
  1.  
     5′ - TGGACTGATTATGGACAGGACTGA - 3′ (forward)
  2.  
     5′ - AGCAGGTCAGCAAAGAACTTATAGC - 3′ (reserve)

All reactions were performed in triplicate. β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hprt1 were used as endogenous controls. Sirt1, Bcl-1 and Bax expression levels were normalized to the mean expression levels of β-actin, GAPDH and hprt1. 

Retinal Superoxide Dismutase and Malondialdehyde Measurement

Immediately after intraperitoneal anesthesia, rat eyes were enucleated and retinas were carefully isolated 36 hours and 5 days after light exposure. Total SOD activity and MDA levels were determined using commercially available kits (Jiancheng Bioengineering, Nanjing, China) according to the manufacturer's instructions. 

Statistical Analysis

All data are presented as means ± SD. One-way ANOVA was used to compare differences among groups, followed by Bonferroni post hoc tests. P less than 0.05 was considered statistically significant. 

Results

HRS Upregulates the Expression of Sirt1 in the Retina After Exposure to Light

Intense light exposure led to significant reductions in a- and b-wave amplitude and ONL cell layer numbers in LE rats when compared with the control group (Figs. 1A, 1B; P < 0.05). Five days of HRS (but not vehicle) treatment significantly reduced light exposure induction of a- and b-wave amplitude and mitigated ONL cell layer number reduction (P < 0.05). 

Figure 1

 

Hydrogen-rich saline upregulated Sirt1 expression in the retina 5 days after light exposure. (A) Representative ERG waveforms and amplitude quantification of a- and b-waves in control, LE, LE+vehicle, and LE+HRS groups 5 days after light exposure (n = 6, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.05, ##P < 0.01 versus the LE+vehicle group). (B) Representative images of H&E staining of retinal sections and quantification of the ONL cell layer number 5 days after light exposure (n = 6, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.05, ##P < 0.01 versus the LE+vehicle group). Scale bar: 50 μm. (C) Reverse transcription–PCR analysis of Sirt1 mRNA expression (n = 3, *P < 0.05, versus the LE group; #P < 0.05, versus the LE+vehicle group). (D) Western blot showing Sirt1 protein expression (n = 3, *P < 0.05, versus the LE group; #P < 0.05, versus the LE+vehicle group).

We examined Sirt1 mRNA expression using real-time PCR in the retina prior to and 5 days after light exposure (Fig. 1C). Compared with the control group, light exposure caused significant Sirt1 mRNA downregulation (P < 0.05). Sirt1 mRNA expression was significantly increased in the LE+HRS group compared with the LE group (P < 0.05). There was no significant difference in Sirt1 mRNA expression between the LE+vehicle and the LE groups. Consistent with the observed Sirt1 mRNA expression, Sirt1 protein expression was significantly decreased in the LE group when compared with the control group (P < 0.05). Hydrogen-rich saline, but not the vehicle, treatment significantly reduced light-induced Sirt1 protein downregulation (Fig. 1D). 

Resveratrol Reduces Light-Induced Damage

The Sirt1 activator REV significantly mitigated the light exposure induced a- and b-wave amplitude decrease and ONL cell layer number reduction (P < 0.05). There were no significant differences in a- and b-wave amplitude or ONL cell layer number when LE and LE+vehicle groups were compared. The retinal protective effect of REV was similar to HRS (Figs. 2A, 2B). 

Figure 2

 

Resveratrol reduced light-induced retinal damage. (A) Representative ERG waveforms and amplitude quantification of a- and b-waves in the control, LE, LE+vehicle, and LE+HRS groups after 5 days after light exposure (n = 6, *P < 0.01 versus the LE group). (B) Representative H&E staining images of retinal sections 5 days after light exposure and quantification of the ONL cell layer number using the stained nuclei (n = 6, *P < 0.05, **P < 0.01, for the LE+HRS group versus the LE group; #P < 0.05, ##P < 0.01, for the LE+REV group versus the LE group). Scale bar: 20 μm.

EX-527 Inhibits the Protective Effect of HRS on Retinal Function and Morphology

To investigate whether Sirt1 mediated the retinal protective effect of HRS, the Sirt1 inhibitor EX-527 was intravitreally injected in HRS-treated rats immediately after light exposure. Hydrogen-rich saline treatment significantly mitigated the light-induced decrease in a- and b-wave amplitude and ONL cell nuclei layer number reduction (P < 0.05). The Sirt1 inhibitor EX-527 significantly inhibited HRS morphology and retinal function protection (P < 0.05; Figs. 3A, 3B). 

Figure 3

 

Sirt1 inhibitor EX-527 attenuates HRS light-induced retinal damage protection. (A) Representative ERG waveforms and amplitude quantification of a- and b-waves in the LE, LE+HRS, LE+EX-527, and LE+vehicle groups 5 days after light exposure (n = 6, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.05, ##P < 0.01 versus the LE+HRS+EX-527 group). (B) Representative images of H&E staining of retinal sections and quantification of the ONL cell layer number 5 days after light exposure (n = 6, *P < 0.05, **P < 0.01, the LE+HRS group versus the LE+HRS+EX-527 group; #P < 0.05, ##P < 0.01, the LE+vehicle+HRS group versus the LE group). Scale bar: 20 μm.

siRNA Suppression of Sirt1 Blocks HRS Protection From Light-Induced Retinal Damage

We examined Sirt1's role in HRS-mediated retinal protection in HRS-treated rats by intravitreally injecting Sirt1 siRNA 12 hours before and three days after light exposure. Western blot results show that Sirt1 protein was significantly decreased after Sirt1 siRNA injection (Fig. 4A). Intravitreal injection of Sirt1 siRNA significantly inhibited HRS-induced Sirt1 upregulation (P < 0.05). No significant differences in Sirt1 expression were observed when the LE+HRS and LE+ HRS+DEPC water groups were compared (Fig. 4B). Furthermore, the retinal protective effects of HRS on a- and b-wave amplitude and ONL cell layer number were significantly inhibited by Sirt1 siRNA treatment (Fig. 4C, 4D; P < 0.05). 

Figure 4

 

Sirt1 siRNA blocked HRS-mediated retinal protection. (A) Representative Western blot and quantitative analysis of Sirt1 protein expression after Sirt1 siRNA (left) or DEPC water (right) injection. Sirt1 siRNA was intravitreally injected 12 hours before and 3 days after light exposure. Sirt1 expression was detected from day 1 to 6 after injection (n = 3, *P < 0.05, versus the 0 day group). (B) Representative Western blot and quantitative analysis of Sirt1 protein expression 5 days after light exposure (n = 3, *P < 0.05 versus the LE group; #P < 0.05 versus the LE+siRNA-Sirt1+HRS group). (C) Representative ERG waveforms and quantification of a- and b-wave amplitudes 5 days after light exposure (n = 6, *P < 0.01 versus the LE group; #P < 0.01 versus the LE +siRNA-Sirt1+HRS group). (D) Representative H&E images of retinal sections and quantification of the ONL cell layer number 5 days after light exposure (n = 6, *P < 0.01, the LE+HRS group versus the LE +siRNA-Sirt1+HRS group; #P < 0.01, the LE+vehicle+HRS group versus the LE group). Scale bar: 20 μm.

HRS Reduced Light Exposure Induced Apoptosis Through Sirt1 Activation

To investigate Sirt1 mediation of HRS protective mechanisms, we examined expression of Bcl-2 and Bax mRNA and caspase-3 protein in HRS-treated rats 5 days after light exposure. Intense light exposure significantly downregulated Bcl-2, upregulated Bax mRNA, and upregulated cleaved caspase-3 protein expression (P < 0.05). Hydrogen-rich saline treatment significantly increased Bcl-2, decreased Bax, and decreased cleaved caspase-3 expression in rats after light exposure (Figs. 5A, 5B; P < 0.05). Resveratrol produced an effect similar to HRS treatment. Sirt1 siRNA significantly decreased Bcl-2 expression and increased Bax mRNA and cleaved caspase-3 protein expression in HRS-treated rats (Figs. 5C, 5D; P < 0.05). 

Figure 5

 

Hydrogen-rich saline inhibits light exposure-induced apoptosis in the retina though Sirt1 activation. (A) Representative Western blot and quantitative analysis of caspase-3 expression 5 days after light exposure (n = 3, *P < 0.05 versus the LE group; #P < 0.05 versus the LE+vehicle group). (B) Bcl-2 and Bax mRNA expression was analyzed using quantitative real-time PCR 5 days after light exposure (n = 6, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.01 versus the LE+HRS group). (C) Representative Western blot and quantitative analysis of caspase-3 protein expression (n = 3, *P < 0.05 versus the LE group; #P < 0.05 versus the LE+HRS group). (D) Bcl-2 and Bax mRNA expression was analyzed with quantitative real-time PCR (n = 5, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.01 versus the LE+HRS group).

HRS Alleviated Light Exposure Induced Oxidant-Stress Through Upregulating Sirt1 Expression

We also investigated whether Sirt1 mediated the protective effect of HRS via oxidant-stress inhibition by examining SOD activity and the level of MDA in retinas 36 hours and 5 days after light exposure. When compared with the control group, intense light exposure significantly decreased SOD activity and increased the level of MDA (P < 0.05). Hydrogen-rich saline treatment significantly elevated SOD activity and reduced the level of MDA in rats after light exposure (Figs. 6A, 6C; P < 0.05). Resveratrol treatment produced a similar effect. Sirt1 siRNA significantly mitigated the effect of HRS treatment (Figs. 6B, 6D; P < 0.05). 

Figure 6

 

Hydrogen-rich saline inhibits light exposure-induced oxidative stress in the retina by upregulating Sirt1 expression. (A, B) Total SOD activity and MDA levels in retinas 36 hours after light exposure (n = 6, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.05, ##P < 0.01 versus the LE+HRS group). (C, D) Total SOD activity and MDA levels in retinas 5 days after light exposure (n = 6, *P < 0.05, **P < 0.01 versus the LE group; #P < 0.05, ##P < 0.01 versus the LE+HRS group).

Discussion

This study reveals, for the first time, that HRS protects the retina through the Sirt1 signaling pathway. Sirt1 protein and mRNA expression were decreased in rat retinas after light exposure, but were significantly increased after HRS treatment. Hydrogen-rich saline light-induced damage protection was mimicked by the Sirt1 activator resveratrol and weakened by the Sirt1 inhibitor EX-527. Furthermore, Sirt1 siRNA blocked HRS inhibition of light-induced retinal injury. This suggests that HRS inhibits light-induced retinal damage by upregulating Sirt1. 

H₂ has recently been reported as a promising drug for the treatment of various diseases in clinical and animal studies.^37–39 Several lines of evidence indicate that H₂ protects cells and tissue from oxidative stress by reducing ROS and increasing antioxidant enzyme activity. These antioxidants include SOD and catalase (CAT).^9,10 Additionally, H₂ suppresses inflammation by inhibiting IL-6 and TNF-α.^40,41 H₂ has also been reported to inhibit apoptosis by enhancing pAkt activation, increasing Bcl-2 expression, and reducing Bax and cleaved caspase-3 expression.^17,42 However, none of these studies described the mechanism by which H₂ mediated retinal protection. 

In an interesting parallel with the protective activity of H₂, Sirt1 has been reported to exert antioxidative effects through ROS reduction, upregulation of antioxidant enzymes (such as SOD and CAT), and inhibition of apoptosis via regulation of the Bcl-2 family and caspase-3.^43,44 Additionally, it has been reported that Sirt1 activates Akt phosphorylation.⁴⁵ Therefore, Sirt1 may be involved in the H₂ signaling pathway. We previously demonstrated significant light-induced retinal damage mitigation in rats after intraperitoneal injection of HRS.²⁰ Furthermore, overexpression of Sirt1 has been reported to protect the retina from light-induced damage.^30,33 Therefore, it is possible that Sirt1 mediates the retinal protective effect of HRS. 

In this study, we investigated Sirt1 expression in rats treated with HRS after light exposure. Consistent with a previous report,²⁷ we found that light exposure downregulated Sirt1 expression. Hydrogen-rich saline significantly reduced light-induced Sirt1 downregulation, suggesting that HRS may mediate retinal protection by activating Sirt1. Furthermore, we found that the Sirt1 activator resveratrol mimicked the retinal protective effect of HRS. We also observed that the Sirt1 specific inhibitor EX-527 blocked the effect of HRS. Moreover, we found that Sirt1 siRNA knockdown blocked the protective effect of HRS. Our results are also supported by recent studies indicating that resveratrol reduces retinal damage by upregulating endogenous Sirt1 activity.^46,47 Additionally, Sirt1 upregulation has been shown to inhibit light-induced retinal damage in rats.^30,33 

It is generally believed that light exposure induces the apoptosis of retinal cells.^48–50 We investigated whether Sirt1 mediates HRS retinal protection by regulating apoptosis. We found that HRS treatment significantly increased expression of antiapoptotic factor Bcl-2, and decreased expression of proapoptotic factors Bax and cleaved caspase-3. Resveratrol produced antiapoptotic effects similar to HRS treatment. Furthermore, Sirt1 siRNA suppressed apoptotic inhibition by HRS. This suggests that Sirt1 mediates the retinal protection activity of HRS by suppressing apoptosis (Fig. 7). Several studies have reported that Sirt1 reduces apoptosis and promotes cell survival by regulating DNA stability and downregulating the apoptotic factor p53.^25,51 Sirt1 can also regulate p53 deacetylation.^52,53 Thus, it is likely that p53 is involved in HRS-mediated retinal protection. 

Figure 7

 

Schematic representation of the Sirt1 signaling pathway involved in HRS mitigation of light-induced ONL cell damage.

Oxidative stress plays an important role in retinal photic injury.⁵⁴ It has been reported that HRS reduces oxidative stress and downregulates MDA levels in animal models of retinopathy.^10,55,56 In the present study, we found that HRS treatment significantly increased SOD and decreased MDA levels 36 hours and 5 days after light exposure. Resveratrol inhibited oxidative-stress in a manner similar to HRS treatment. Furthermore, Sirt1 siRNA blocked HRS inhibition of oxidative-stress. This suggests that Sirt1 mediates the retinal protective activity of HRS by upregulating SOD and downregulating MDA during the process of photoreceptor degeneration (Fig. 7). Zhuge et al.⁵⁷ recently reported that Sirt1 regulates fullerenol-mediated protection of RPE cells from oxidative stress-induced premature senescence, suggesting that Sirt1 may play a protective role in oxidative stress-related retinal injury. Furthermore, several studies have reported that Sirt1 promotes intracellular ROS reduction by activating AMP-activated protein kinase (AMPK)^58,59 and upregulating PGC-1α to increase SOD2 expression.⁶⁰ Future studies are required to identify the Sirt1-mediated signaling pathways involved in HRS-mediated retinal protection. 

In summary, we found that HRS increased Sirt1 mRNA and protein expression in rats after light-induced retinal damage. Additionally, we found that HRS treatment improved visual function and ONL cell survival. Downregulating Sirt1 blocked the HRS-mediated retinal protection, and upregulating Sirt1 mimicked the retinal protective effects of HRS. Our findings indicate that Sirt1 mediates HRS-induced retinal protection by inhibiting apoptosis and oxidative-stress. 

Acknowledgments

Disclosure: L.-S. Qi, None; L. Yao, None; W. Liu, None; W.-X. Duan, None; B. Wang, None; L. Zhang, None; Z.-M. Zhang, None