Total RNA was isolated from fresh mouse RPE/choroid using Trizol and the RNeasy mini kit (Qiagen Inc., City, State, Country). RNA yield was determined by a Nanodrop 2000 spectrophotometer; 100 ng of total RNA was converted into cDNA using the High Capacity RNA-to-cDNA kit (catalog number 4387406; Applied Biosystems, Germantown, MD, USA). The quantitative PCR was performed using the Power SYBR Green detector (Life Technologies Inc.) on the 7300 RealTime PCR system (Applied Biosystems Corp., Foster City, CA, USA), starting with 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. The final primer concentration in each well was 0.5 μM for forward and 0.5 μM for reverse primer with 0.5-μL cDNA. The relative expression of LAMP1 was normalized internally to housekeeping gene GAPDH and analyzed using the delta-delta CT approach, with results expressed as fold change in gene expression. Primer pairs for mouse LAMP1 are forward, CAGCACTCTTTGAGGTGAAAAAC, and reverse, ACGATCTGAGAACCATTCGCA (104 base pairs); and for mouse GAPDH are forward, TCACCACCATGGAGAAGGC, and reverse, GCTAAGCAGTTGGTGGTGCA (169 base pairs).