July 2019
Volume 60, Issue 9
Open Access
ARVO Annual Meeting Abstract  |   July 2019
KCNJ13 nonsense mutation causes Leber Congenital Amaurosis (LCA16) in man but is lethal in mouse model
Author Affiliations & Notes
  • De-Ann M Pillers
    Department of Pediatrics, University of Illinois, Chicago, Illinois, United States
  • Pawan K Shahi
    Pediatrics, University of Wisconsin-Madison, Madison, Wisconsin, United States
  • Bikash Pattnaik
    Pediatrics, University of Wisconsin-Madison, Madison, Wisconsin, United States
  • Footnotes
    Commercial Relationships   De-Ann Pillers, None; Pawan Shahi, None; Bikash Pattnaik, None
  • Footnotes
    Support  NIH Grant EY024995
Investigative Ophthalmology & Visual Science July 2019, Vol.60, 4939. doi:https://doi.org/
  • Views
  • Share
  • Tools
    • Alerts
      ×
      This feature is available to authenticated users only.
      Sign In or Create an Account ×
    • Get Citation

      De-Ann M Pillers, Pawan K Shahi, Bikash Pattnaik; KCNJ13 nonsense mutation causes Leber Congenital Amaurosis (LCA16) in man but is lethal in mouse model. Invest. Ophthalmol. Vis. Sci. 2019;60(9):4939. doi: https://doi.org/.

      Download citation file:


      © ARVO (1962-2015); The Authors (2016-present)

      ×
  • Supplements
Abstract

Purpose : Human ocular disease is routinely studied in mouse models due to the established genetic background and the similarity in physiology and anatomy. Mouse models have allowed the elucidation of pathogenic mechanisms of blindness thereby leading to the development of novel treatments such as gene therapy, and resulting in the restoration of vision. We have recently found that substitution of nt 295 in exon 2 of the KCNJ13 gene, which encodes the inwardly rectifying potassium channel Kir7.1, coding region c.158G>A, results in a nonsense mutation at amino acid position 53 (p.W53*). In the current study, we used genome editing to generate a new mouse model for LCA16 based on this nonsense mutation.

Methods : All experiments were performed in accordance with the ARVO Statement for the use of animals in Ophthalmic and Vision research. Experimental procedures were approved by the University of Wisconsin institutional animal care and use committee. C57Bl/6 mice were used. We designed a gRNA (GAATCCTAATGGACATGCGCTGG) targeting exon 2 of the mouse Kcnj13 gene (NM_001110227.1). For homology-directed repair, the donor oligo carried the mutation p.W53* (TGG to TAG) flanked by 120 bp homologous sequences combined on both sides. Cas9 mRNA, gRNA and donor oligo were co-injected into fertilized eggs. Pups were collected from the surrogate mother and genotyped by sequencing and RFLP analysis.

Results : PCR showed an expected 514 bp product. DNA sequencing confirmed a point mutation (TGG to TAG) in one strand of several F1 mice. Restriction fragment analysis confirmed the presence of 514, 305 and 209 bp bands consistent with being heterozygous carriers. Breeding of heterozygotes resulted in pups that followed a Mendelian inheritance distribution. Of note, homozygous pups did not survive for long in the extra-intensive care environment. Gross necropsy showed partial pulmonary atelectasis and squamous proliferation. All organs were normal in appearance with an indication of inanition, although some food was detected.

Conclusions : Unlike patients who manifest the phenotype of LCA16 with the KCNJ13 nonsense mutation, this mutation resulted in lethality in the gene-edited mouse model. We hypothesize that the alteration of Kcnj13 in the mouse is affecting postnatal survival, suggesting that a conditional knockout or an inducible model will be required to study the LCA16 phenotype anticipated in the mouse model.

This abstract was presented at the 2019 ARVO Annual Meeting, held in Vancouver, Canada, April 28 - May 2, 2019.

×
×

This PDF is available to Subscribers Only

Sign in or purchase a subscription to access this content. ×

You must be signed into an individual account to use this feature.

×