The subjects' total RNA was extracted from the peripheral blood cells using the Tempus system (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized by SuperScript III Reverse Transcriptase (Thermo Fisher Scientific), and amplification between exons 10 and 14 of the CHM mRNA was performed using GoTaq Green Master Mix 2x (Promega Corporation, Madison, WI, USA) and primers 5'TCTTCGCCATTCAGTACAGTGC3' and 5'AGAAGATGTGCAAGTCAAATGAACC3'. The PCR products were separated by electrophoresis in 2% agarose gel, bands were extracted from the gel, DNA was recovered by centrifugation, and Sanger sequencing was performed. The 3500xL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) was used for bidirectional sequencing and Geneious 10.2.5 software (Biomatters, New Zealand) for sequence alignment. The molecular analyses were based on references: NG_009874, NM_000390.3 and NP_000381.1.